Next Article in Journal
Genotype by Environment Interaction Analysis for Grain Yield of Wheat (Triticum aestivum (L.) em.Thell) Genotypes
Previous Article in Journal
Performance of Nigerian Rice Farms from 2010 to 2019: A Stochastic Metafrontier Approach
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 12
Issue 7
10.3390/agriculture12071003
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptome Sequencing of Agave angustifolia Reveals Conservation and Diversification in the Expression of Cinnamyl Alcohol Dehydrogenase Genes in Agave Species

by
Xing Huang
1,
Bochao Xu
2,
Shibei Tan
1,
Yanlei Huang
3,
Jingen Xi
1,
Xu Qin
4,
Tao Chen
4,
Helong Chen
1,
Xiaohan Yang
5,* and
Kexian Yi
1,6,7,8,*
1
Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China
2
School of Life Sciences, Hainan University, Haikou 570228, China
3
College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
4
Guangxi Subtropical Crops Research Institute, Nanning 530001, China
5
Biosciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831, USA
6
Key Laboratory of Integrated Pest Management on Tropical Crops, Ministry of Agriculture and Rural Affairs, Haikou 571101, China
7
Key Laboratory of Low Carbon Green Agriculture in Tropical China, Ministry of Agriculture and Rural Affairs, Haikou 571101, China
8
Hainan Key Laboratory for Monitoring and Control of Tropical Agricultural Pests, Haikou 571101, China
*
Authors to whom correspondence should be addressed.
Agriculture 2022, 12(7), 1003; https://doi.org/10.3390/agriculture12071003
Submission received: 21 June 2022 / Revised: 8 July 2022 / Accepted: 9 July 2022 / Published: 11 July 2022
(This article belongs to the Special Issue Genomics, Genetic/Cell Engineering and Breeding Biotechnology of Fiber Crops)
Browse Figures
Versions Notes

Abstract

:
Agave angustifolia is an important crassulacean acid metabolism plant species, with wide applications in beverage and sisal fiber production. In this study, we carried out a transcriptome analysis of A. angustifolia leaves, generating a total of 58,482,436 clean reads through Illumina paired-end sequencing. De novo transcriptome assembly generated 67,314 unigenes, with about half of them having homologs in four public databases. In the Nr database, Asparagus officinalis was shown to be most closely related to agave, and the early angiosperm Amborella trichopoda was selected as an outgroup species. We further identified five, two, seven, seven, seven, six and six CAD genes in asparagus, amborella, A. deserti, A. tequilana, A. americana, A. hybrid H11648 and A. angustifolia, respectively. The maximum likelihood phylogenetic tree revealed the species-specific expansion of CAD genes in arabidopsis, rice and agave. The expression analysis indicated the conservatively expressed CAD1/2/4/6, providing candidate targets for manipulation to improve lignin traits. The species-specific expression of CAD3/5/7 indicates the existence of different regulatory mechanisms controlling the expression of these genes in agave species. This study presents the first transcriptome dataset of A. angustifolia, facilitating future studies on lignin biosynthesis in agave.

1. Introduction

Agave species are important vegetations in semiarid and arid regions, which are spread from the geographic center of origin in Mexico to many countries or regions in the world [1]. Agave species are typical crassulacean acid metabolism plants with large biomass, high tolerance to the stresses of drought, cold and heat temperature and great potential for bioenergy production in arid and semiarid regions [2,3]. Among the 166 Agave species, A. angustifolia is a local plant species distributed from Mexico to Panama [4]. It is commonly used for producing the fermented and distilled beverage Bacanora [5]. Additionally, A. angustifolia has a high cellulose content (67%) in leaf fiber, which has been applied for breeding the famous agave cultivar Agave hybrid H11648 ((A. amaniensis Trel. & Nowell × A. angustifolia Haw.) × A. amaniensis) [6,7]. It has become the main cultivar for sisal fiber production in tropical areas of Brazil, China and African countries, with the potential to the increase yield by improving fiber-related traits [8,9]. However, the molecular basis of fiber biosynthesis in agave is not well understood. To date, there have been several studies related to fiber traits in agave. A transcriptome comparison between wild and cultivated agave species has revealed six candidate genes related to fiber traits [10]. Five cellulose synthase A (CesA) genes have been identified by transcriptome mining in A. hybrid H11648 [11]. The expression patterns of SMALL AUXIN UP-REGULATED RNA (SAUR) and NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER FAMILY (NPF) family genes have been well characterized, with several genes from the SAUR and NPF families identified as candidate regulators of leaf development [12,13]. Recent studies have revealed the expression patterns of cell wall-related genes in A. sisalana, A. fourcroydes, A. hybrid H11648 and A. tequilana [9,14]. However, the large genomes and the long life-cycles have significantly restricted genetic research in agave, which impose a big challenge to revealing the molecular mechanism of fiber traits [6]. The next generation sequencing technology has undoubtedly become a useful and efficient tool to generate large transcript sequencing datasets in A. angustifolia, facilitating the functional genomics research in this important agave species [15].
Cinnamyl alcohol dehydrogenase (CAD) plays a key enzyme in the metabolic pathway of phenylpropanoid, which catalyzes the reduction of p-coumaricaldehyde, coniferylaldehyde and sinapylaldehyde by NADPH [16]. Their alcohol derivatives will be further polymerized into lignin, a main component of fiber [17]. The CAD gene family has been functionally characterized in various plants, such as arabidopsis, flax, melon, pear, poplar, sorghum, switchgrass, tobacco and wheat [18,19]. It is also an important target for genetic manipulation to control lignin-related phenotypes [20]. Flax mutants of CAD genes show obvious morphological modifications in bast fiber, which provides a typical reference for agave researchers [21]. Thus, we have sequenced and assembled the leaf transcriptome of A. angustifolia based on Illumina sequencing to gain a deep understanding of gene expression in relation to fiber traits. Furthermore, we performed a comparative analysis of CAD genes in five agave species, including A. deserti, A. tequilana, A. americana, A. hybrid H11648 and A. angustifolia. The results will provide new insights into the molecular basis of the underlying lignin traits in agave.

2. Materials and Methods

2.1. Plant Materials and RNA Isolation

The plants of A. deserti, A. tequilana, A. americana, A. hybrid H11648 and A. angustifolia were cultivated in the Wenchang experimental field (19.54° N 110.77° E) of Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences since 2013. The samples of young leaves were collected from three-year-old plants, as previously described [13]. The samples of each species were repeated three times with different individuals as biological replicates and soaked in liquid nitrogen for immediate freezing. The total RNA of each sample was isolated with the Tiangen RNA prep Pure Plant Kit (Tiangen Biomart, Beijing, China) after being ground into powder and then stored in a freezer at −80 °C.

2.2. Illumina Sequencing and Transcriptome Assembly

The total RNA samples of A. angustifolia were delivered to Genoseq Technology Co. Ltd. (Wuhan, Hubei, China), where the experiments of library construction and Illumina sequencing were conducted [22]. The RNA samples were examined with the NanoDrop Spectrophotometers (Thermo Fisher Scientific, Waltham, MA, USA) and the 2100 Bioanalyzer Instrument (Agilent Technologies, Santa Clara, CA, USA). The mRNAs were collected from 10 μg of qualified RNA with poly-T oligo-attached magnetic beads and then fragmented with the TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA). The mRNA fragments were used as templates for first strand cDNA synthesis by M-MuLV Reverse Transcriptase (RNase H) together with a random hexamer primer. The second strand cDNA was synthesized with DNA Polymerase I and RNase H. The double-stranded cDNA fragments were modified with single ‘A’ bases and then added with adapters, which were used to construct a cDNA library after gel purification and PCR amplification. The sequencing was carried out by the Illumina HiSeq platform which generated paired-end raw reads with 150 bp at length.
The raw reads were submitted to the public database Sequence Read Archive (SRA) under the accession PRJNA837721 [23]. Clean reads were obtained after filtering the sequences of the adapter and low quality with Cutadapt and Trimmomatic software, respectively [24,25]. The Trinity software was used for de novo transcriptome assembly, which was annotated according to public databases, including the NCBI non-redundant protein database (Nr), the Gene Ontology (GO), the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Swiss-Prot [26,27,28,29,30].

2.3. Identification and Phylogenetic Analysis of CAD Genes

The CAD proteins of Arabidopsis thaliana (9) and Oryza sativa (12) were utilized as a query sequence to search homologous genes using tblastn method [31,32,33]. The previously published transcriptome data of five species in agave genus were selected as the database for the tblastn search, including A. deserti, A. tequilana, A. americana, A. hybrid H11648 and A. angustifolia [2,11,14,34]. Asparagus officinalis (Asparagoideae) was selected as a reference species due to its close phylogenetic position with Agave species (Agavoideae) since they were all belonging to Asparagaceae [35]. The early angiosperm Amborella trichopoda was selected as an outgroup species [36]. Agave CAD transcripts with a full coding region were identified by the ORF-FINDER software [37]. The full-length agave CAD genes were selected to calculate the protein length (aa), molecular weight (Da) and theoretical isoelectric point (pI) by using the software ProtParam tool [38]. The subcellular localization of proteins was predicted by using the CELLO software [39]. The full-length CAD proteins of the nine species (amborella, arabidopsis, rice, A. deserti, A. tequilana, A. americana, A. hybrid H11648 and A. angustifolia) were aligned by the ClustalX method for phylogenetic analysis to construct the maximum likelihood tree with a bootstrap value of 1000 trials using the MEGA 5.0 software [40]. These protein sequences of the nine species were further aligned in DNAMAN7 software to the detection of conserved amino acid residues [41].

2.4. Gene Expression Analysis

The clean reads were selected and mapped to the assembled A. angustifolia transcriptome sequences to calculate read counts of unigenes with the RSEM method, which were further normalized into reads per kilobase of transcript per million mapped reads (RPKM) [42,43]. The RPKM values of CAD genes in other agave species were calculated by the RSEM method according to previous studies and then normalized with the reference gene protein phosphatase 2A (PP2A) [2,11,34,42]. A QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) was selected for RT-qPCR validation of the gene expression. The program consisted of the initial stage (94 °C, 30 s), the cycle stage of 40 times (94 °C, 5 s and 60 °C, 30 s) and the dissociation stage. The GoScript Reverse Transcription System (Promega, Madison, WI, USA) was utilized for reverse transcription of RNA samples. The reaction solution of 20 μL contained 10 μL of TransStart Tip Green qPCR Supermix (Transgen Biotech, Beijing, China), 7.6 μL of ddH2O, 0.5 μL of each gene-specific primer (10 μM), 1 μL of cDNA template and 0.4 μL of Passive Reference Dye (50×) (Transgen Biotech, Beijing, China). A technical replicate was conducted 3 times for each sample. Seven pairs of primers specific for agave CAD genes were synthesized after a primer design by using the Primer 3 software (Table 1) [44]. The ΔΔCt method was used to calculate relative expression levels with the reference gene protein phosphatase 2A (PP2A) as an endogenous control [12,45].

3. Results

3.1. De Novo Assembly of A. angustifolia Transcriptome

The leaf sample of A. angustifolia was selected for Illumina paired-end sequencing, which generated 72,184,668 raw reads. A total of 58,482,436 clean reads were obtained, with a total of 8,166,023,895 bp in length. The GC content, Q20 value (base quality > 20) and Q30 value (base quality > 30) were 49.05%, 98.43% and 95.17%, respectively. The clean data was de novo assembled into 67,314 unigenes with the mean and N50 length of 671 bp and 1169 bp, respectively (Table S1). Among these, the lengths of 44,109 unigenes (65.53%) ranged from 200–500 bp (Figure 1). There were 10,596, 4897, 3335, 3003 and 1374 unigenes with lengths in the range of 500–1000 bp, 1000–1500 bp, 1500–2000 bp, 2000–3000 bp and >3000 bp, respectively.

3.2. Functional Annotation

All the unigenes of A. angustifolia transcriptome were utilized to search against four public databases for functional annotation (Table S1). A total of 35,798 unigenes were annotated in at least one public database. There were 35,673 and 24,751 unigenes having homologs in the Nr and Swiss-Prot databases, respectively. In the Nr database, the most closely related species is Asparagus officinalis, with orthologs to 21,727 (60.9%) A. angustifolia unigenes (Figure 1). Based on the GO annotation, 22,765 unigenes were assigned into seven subcategories (Figure 2). Among these, four subcategories were the most abundant, including ‘intracellular’ (8496 unigenes), ‘binding’ (6650 unigenes), ‘metabolic process’ (2014 unigenes) and ‘cytoplasm’ (1224 unigenes). Based on the KEGG, 10,841 unigenes were categorized into 18 pathways (Figure 2). The top four pathways were ‘carbohydrate metabolism’, ‘translation’, ‘folding, sorting and degradation’ and ‘amino acid metabolism’ with 3801, 3035, 2797 and 2015 unigenes, respectively.

3.3. Identification of CAD Genes in Agaves

The CAD proteins from arabidopsis (9) and rice (12) were used as query sequences to search against the asparagus and amborella genomes, which identified five and two CAD genes, respectively (Table S2). These 28 CAD proteins were further utilized for sequence retrieval in the transcriptomes of five Agave species, including A. deserti, A. tequilana, A. americana, A. hybrid H11648 and A. angustifolia, with seven, seven, seven, six and six full-length CAD genes identified in these five species, respectively (Table S2). We did not find CAD3 in A. hybrid H11648 or CAD7 in A. angustifolia. Their sequence lengths ranged from 1148 to 2548 bp, with the lengths of predicted proteins ranging from 353 aa to 370 aa. The molecular weights and theoretical pI of these proteins were 38,263.10–39,952.18 Da and 5.54–7.15, respectively. Additionally, CAD1 and CAD5 genes in Agave species were predicted with their subcellular localizations at the plasma membrane and the chloroplast, respectively. The other agave CAD genes, including CAD2/3/4/6/7, were predicted to be localized in the cytoplasm.

3.4. Phylogeny of CAD Proteins

The 61 CAD proteins of nine plant species were used for phylogenetic analysis and clustered into three groups according to a previous study (Figure 3) [19]. Group I was further divided into four subgroups. The two amborella proteins were clustered into Group I and II. Agave proteins were distributed in each group or subgroup, except IIIb and IIIc which contain only arabidopsis and rice sequences, respectively. Asparagus proteins spread in group I, II and IIId. In addition, group IIId contained monocot sequences only. All of these proteins and the agave proteins were further aligned to identify conserved domains, revealing 55 and 99 conserved amino acid residues, respectively (Figure S1).

3.5. Expression of Agave CAD Genes

The expression data of agave transcriptomes was selected for in silico expression analysis [2,11,33]. The result indicated the relatively high expression patterns of CAD1/2/4/6 in all agave species (Figure 4A, Table S1). CAD3 showed a moderate expression pattern in A. deserti, A. tequilana and A. angustifolia and no expression in A. americana and A. H11648. CAD5 was highly expressed in both A. H11648 and A. angustifolia, with extremely low or no expression in A. deserti and A. americana. The high expression of CAD7 was only detected in A. tequilana. We further carried out the qRT-PCR validation (Figure 4B). The result revealed that CAD1 showed high expression in A. deserti and A. hybrid H11648, and moderate expression in A. angustifolia and A. americana. CAD2 was highly expressed in A. angustifolia and moderately expressed in A. americana. There were low levels of expression of CAD3/7 in all of the species. CAD4 and CAD6 showed moderate expression in A. angustifolia and A. hybrid H11648, respectively. CAD5 had high expression in A. angustifolia and moderate expression in A. hybrid H11648. We also conducted a correlation analysis between the results of RNA-Seq and qRT-PCR, showing a significant (p < 0.01) correlation (Figure 4C).

4. Discussion

4.1. Features of A. angustifolia Transcriptome

The fast development of sequencing technology has provided an efficient tool for studying gene functions in plants without genome sequencing data, especially such as agave species with extremely large genomes [6,15]. So far, few gene sequences of A. angustifolia have been submitted to GenBank, leaving a knowledge gap regarding the genetic basis of important traits in this agave species. Hence, we assembled the transcriptome with 67,314 unigenes, which will be a useful resource for studying gene functions in A. angustifolia. In this new assembly, the number of unigenes was similar to that in A. americana but less than those in A. deserti, A. tequilana and A. hybrid H11648 [2,11,34]. This inconsistency might be caused by the difference in transcriptome assembly method and sample collection [47]. In general, there are about 18% of the unigenes with sequence lengths over 1000 bp (Table S1). In addition, it seems the longer the sequence length, the higher the chance of identifying homologs in public databases (Figure 1). This might be explained by the existence of a large number of non-coding RNAs in A. angustifolia transcriptome [48]. Additionally, more than half of the A. angustifolia unigenes have homologs in public databases, facilitating the prediction of agave gene functions based on sequence homology [11]. Various genes related to fiber traits have been identified in agave species, including CesA, SAUR and NPF families [11,12,13]. Moreover, our comparative analysis revealed the close phylogenetic relationship between A. angustifolia and asparagus, both belonging to the Asparagaceae family [49].

4.2. Candidate CAD Genes for Lignin Biosynthesis in Agaves

Lignin is a main component to form the cell wall structure in plants, and also an important secondary metabolite derived from the phenylpropanoid pathway [50]. As the last enzyme in lignin biosynthesis, the manipulation of CAD genes has been successfully applied in the improvement of the fiber traits in flax [21]. Thus, we carried out the sequence retrieval of CAD genes in asparagus and five agave species. As a result, we identified five, seven, seven, seven, six and six CAD genes in asparagus, A. deserti, A. tequilana, A. americana, A. hybrid H11648 and A. angustifolia, respectively (Table S1). It seems that the CAD gene family size in asparagus and agave is smaller than that in arabidopsis and rice. Our phylogenetic analysis revealed diverse evolution patterns of CAD genes, including cross-species conservation (group I and II) and lineage-specific expansion in arabidopsis (group IIIb), rice (group IIIc) and monocots (group IIId), respectively (Figure 3). Additionally, our RNA-Seq analysis did not detect the expression of CAD3 in A. hybrid H11648 and CAD7 in A. angustifolia. However, we can assume the existence of CAD3/7 in the genomes of A. hybrid H11648 and A. angustifolia since the two genes exist in both wild and domesticated agave species [10]. This discrepancy might be caused by their low expressions detected in the leaf samples, which is also validated by the qRT-PCR result (Figure 4). It might be related to the tissue-specific expression of CAD genes [51]. Moreover, the extremely low expression of CAD3 in A. hybrid H11648 might also be related to gene expression dominance when compared with one of its parents, A. angustifolia [52]. Our expression analysis revealed the conservatively expressed CAD genes (CAD1/2/4/6) in agave species, which could be considered as candidate targets for manipulation to improve lignin traits [19]. The species-specific expression of CAD3/5/7 indicates the existence of a different regulatory mechanism in agave species, including transcription regulations [10,11].

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture12071003/s1, Figure S1: Alignment of CAD proteins in the nine species (A) and in agave species (B). Conserved amino acid residues are highlighted in black color.; Table S1: Details and annotation information (in Nr, GO, KEGG and Swiss-Prot databases) of unigenes.; Table S2: The CAD gene family in asparagus and agave.

Author Contributions

Conceptualization, X.H., X.Y. and K.Y.; formal analysis, X.H.; investigation, B.X., S.T., Y.H., X.Q. and H.C.; resources, J.X. and T.C.; writing—original draft preparation, X.H.; writing—review and editing, X.Y. and K.Y.; supervision, K.Y.; funding acquisition, X.H. and K.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Natural Science Foundation of China (32001598), Hainan Provincial Natural Science Foundation of China (322MS112), China Agriculture Research System of MOF and MARA (CARS-16), Central Public-interest Scientific Institution Basal Research Fund (1630042022005) and the innovation platform for Academicians of Hainan Province.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are contained within the article or Supplementary Materials.

Acknowledgments

We would like to thank Bo Wang from Huazhong Agricultural University for his thorough suggestions on experiment design.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Good-Avila, S.V.; Souza, V.; Gaut, B.S.; Eguiarte, L.E. Timing and rate of speciation in Agave (Agavaceae). Proc. Natl. Acad. Sci. USA 2006, 103, 9124–9129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Gross, S.M.; Martin, J.A.; Simpson, J.; Abraham-Juarez, M.J.; Wang, Z.; Visel, A. De novo transcriptome assembly of drought tolerant CAM plants, Agave deserti and Agave tequilana. BMC Genom. 2013, 14, 563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Yang, X.; Cushman, J.C.; Borland, A.M.; Edwards, E.; Wullschleger, S.D.; Tuskan, G.A.; Owen, N.A.; Griffiths, H.; Smith, J.A.; De Paoli, H.C.; et al. A roadmap for research on crassulacean acid metabolism (CAM) to enhance sustainable food and bioenergy production in a hotter, drier world. New Phytol. 2015, 207, 491–504. [Google Scholar] [CrossRef] [PubMed]
  4. García-Mendoza, A.; Chiang, F. The confusion of Agave vivipara L. and A. angustifolia Haw., two distinct taxa. Brittonia 2003, 55, 82–87. [Google Scholar] [CrossRef]
  5. Gutiérrez-Coronado, M.; Acedo-Félix, E.; Valenzuela-Quintanar, A. Bacanora industry and its process of production. Cienc. Tecnol. Aliment. Food 2007, 5, 394–404. [Google Scholar] [CrossRef]
  6. Robert, M.L.; Lim, K.Y.; Hanson, L.; Sanchez-Teyer, F.; Bennett, M.D.; Leitch, A.R.; Leitch, I.J. Wild and agronomically important Agave species (Asparagaceae) show proportional increases in chromosome number, genome size, and genetic markers with increasing ploidy. Bot. J. Linn. Soc. 2008, 158, 215–222. [Google Scholar] [CrossRef] [Green Version]
  7. Rosli, N.A.; Ahmad, I.; Abdullah, I. Isolation and characterization of cellulose nanocrystals from Agave angustifolia fibre. Bioresources 2013, 8, 1893–1908. [Google Scholar] [CrossRef] [Green Version]
  8. Jin, G.; Huang, X.; Chen, T.; Qin, X.; Xi, J.; Yi, K. The complete chloroplast genome of agave hybrid 11648. Mitochondrial DNA B Resour. 2020, 5, 2345–2346. [Google Scholar] [CrossRef]
  9. Raya, F.T.; Marone, M.P.; Carvalho, L.M.; Rabelo, S.C.; Paula, M.S.; Campanari, M.F.Z.; Freschi, L.; Mayer, J.L.S.; Silva, O.R.R.F.; Mieczkowski, P.; et al. Extreme physiology: Biomass and transcriptional profiling of three abandoned Agave cultivars. Ind. Crops Prod. 2021, 172, 114043. [Google Scholar] [CrossRef]
  10. Huang, X.; Wang, B.; Xi, J.; Zhang, Y.; He, C.; Zheng, J.; Gao, J.; Chen, H.; Zhang, S.; Wu, W.; et al. Transcriptome comparison reveals distinct selection patterns in domesticated and wild Agave species, the important CAM plants. Int. J. Genom. 2018, 2018, 5716518. [Google Scholar] [CrossRef] [Green Version]
  11. Huang, X.; Xiao, M.; Xi, J.; He, C.; Zheng, J.; Chen, H.; Gao, J.; Zhang, S.; Wu, W.; Liang, Y.; et al. De novo transcriptome assembly of Agave H11648 by Illumina sequencing and identification of cellulose synthase genes in Agave species. Genes 2019, 10, 103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Deng, G.; Huang, X.; Xie, L.; Tan, S.; Gbokie, T., Jr.; Bao, Y.; Xie, Z.; Yi, K. Identification and Expression of SAUR Genes in the CAM Plant Agave. Genes 2019, 10, 555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Tan, S.; Liang, Y.; Huang, Y.; Xi, J.; Huang, X.; Yang, X.; Yi, K. Phylogeny and Expression Atlas of the NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER FAMILY in Agave. Plants 2022, 11, 1434. [Google Scholar] [CrossRef] [PubMed]
  14. Maceda-López, L.F.; Góngora-Castillo, E.B.; Ibarra-Laclette, E.; Morán-Velázquez, D.C.; Girón Ramírez, A.; Bourdon, M.; Villalpando-Aguilar, J.L.; Toomer, G.; Tang, J.Z.; Azadi, P.; et al. Transcriptome Mining Provides Insights into Cell Wall Metabolism and Fiber Lignification in Agave tequilana Weber. Plants 2022, 11, 1496. [Google Scholar] [CrossRef]
  15. Schuster, S.C. Next-generation sequencing transforms today’s biology. Nat. Methods 2008, 5, 16–18. [Google Scholar] [CrossRef]
  16. Weng, J.K.; Chapple, C. The origin and evolution of lignin biosynthesis. New Phytol. 2010, 187, 273–285. [Google Scholar] [CrossRef]
  17. Vanholme, R.; Demedts, B.; Morreel, K.; Ralph, J.; Boerjan, W. Lignin biosynthesis and structure. Plant Physiol. 2010, 153, 895–905. [Google Scholar] [CrossRef] [Green Version]
  18. Qi, K.; Song, X.; Yuan, Y.; Bao, J.; Gong, X.; Huang, X.; Khanizadeh, S.; Zhang, S.; Tao, S. CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri). Plants 2021, 10, 1444. [Google Scholar] [CrossRef]
  19. Preisner, M.; Wojtasik, W.; Kostyn, K.; Boba, A.; Czuj, T.; Szopa, J.; Kulma, A. The cinnamyl alcohol dehydrogenase family in flax: Differentiation during plant growth and under stress conditions. J. Plant Physiol. 2018, 221, 132–143. [Google Scholar] [CrossRef]
  20. Vanholme, R.; Morreel, K.; Darrah, C.; Oyarce, P.; Grabber, J.H.; Ralph, J.; Boerjan, W. Metabolic engineering of novel lignin in biomass crops. New Phytol. 2012, 196, 978–1000. [Google Scholar] [CrossRef] [Green Version]
  21. Chantreau, M.; Grec, S.; Gutierrez, L.; Dalmais, M.; Pineau, C.; Demailly, H.; Paysant-Leroux, C.; Tavernier, R.; Trouvé, J.P.; Chatterjee, M.; et al. PT-Flax (phenotyping and TILLinG of flax): Development of a flax (Linum usitatissimum L.) mutant population and TILLinG platform for forward and reverse genetics. BMC Plant Biol. 2013, 13, 159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Huang, X.; Chen, J.; Bao, Y.; Liu, L.; Jiang, H.; An, X.; Dai, L.; Wang, B.; Peng, D. Transcript profiling reveals auxin and cytokinin signaling pathways and transcription regulation during in vitro organogenesis of ramie (Boehmeria nivea L. Gaud). PLoS ONE 2014, 9, e113768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Katz, K.; Shutov, O.; Lapoint, R.; Kimelman, M.; Brister, J.R.; O’Sullivan, C. The Sequence Read Archive: A decade more of explosive growth. Nucleic Acids Res. 2022, 50, D387–D390. [Google Scholar] [CrossRef] [PubMed]
  24. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
  26. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Green Version]
  27. Bairoch, A.; Apweiler, R. The SWISS-PROT protein sequence data bank and its supplement TrEMBL in 1999. Nucleic Acids Res. 1999, 27, 49–54. [Google Scholar] [CrossRef]
  28. Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotech. 2011, 29, 644–652. [Google Scholar] [CrossRef] [Green Version]
  29. Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef]
  30. Pruitt, K.D.; Tatusova, T.; Maglott, D.R. NCBI Reference Sequence (RefSeq): A curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res. 2005, 33, D501–D504. [Google Scholar] [CrossRef] [Green Version]
  31. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  32. Kim, S.J.; Kim, M.R.; Bedgar, D.L.; Moinuddin, S.G.; Cardenas, C.L.; Davin, L.B.; Kang, C.; Lewis, N.G. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 2004, 101, 1455–1460. [Google Scholar] [CrossRef] [Green Version]
  33. Park, H.L.; Kim, T.L.; Bhoo, S.H.; Lee, T.H.; Lee, S.W.; Cho, M.H. Biochemical Characterization of the Rice Cinnamyl Alcohol Dehydrogenase Gene Family. Molecules 2018, 23, 2659. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Abraham, P.E.; Yin, H.; Borland, A.M.; Weighill, D.; Lim, S.D.; De Paoli, H.C.; Engle, N.; Jones, P.C.; Agh, R.; Weston, D.J.; et al. Transcript, protein and metabolite temporal dynamics in the CAM plant Agave. Nat. Plants 2016, 2, 16178. [Google Scholar] [CrossRef] [Green Version]
  35. Harkess, A.; Zhou, J.; Xu, C.; Bowers, J.E.; Van der Hulst, R.; Ayyampalayam, S.; Mercati, F.; Riccardi, P.; McKain, M.R.; Kakrana, A.; et al. The asparagus genome sheds light on the origin and evolution of a young Y chromosome. Nat. Commun. 2017, 8, 1279. [Google Scholar] [CrossRef]
  36. Amborella Genome Project. The Amborella genome and the evolution of flowering plants. Science 2013, 342, 1241089. [Google Scholar] [CrossRef]
  37. Rombel, I.T.; Sykes, K.F.; Rayner, S.; Johnston, S.A. ORF-FINDER: A vector for high-throughput gene identification. Gene 2002, 282, 33–41. [Google Scholar] [CrossRef]
  38. ProtParam Tool. Available online: web.expasy.org/protparam/ (accessed on 2 June 2022).
  39. Yu, C.S.; Chen, Y.C.; Lu, C.H.; Hwang, J.K. Prediction of protein subcellular localization. Proteins 2006, 64, 643–651. [Google Scholar] [CrossRef]
  40. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. DNAMAN7. Available online: www.lynnon.com (accessed on 2 June 2022).
  42. Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 2011, 12, 323. [Google Scholar] [CrossRef] [Green Version]
  43. Mortazavi, A.; Williams, B.A.; Mccue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef] [PubMed]
  44. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Green Version]
  45. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  46. Zolfaghari, F.; Khosravi, H.; Shahriyari, A.; Jabbari, M.; Abolhasani, A. Hierarchical cluster analysis to identify the homogeneous desertification management units. PLoS ONE 2019, 14, e0226355. [Google Scholar] [CrossRef]
  47. Sadamoto, H.; Takahashi, H.; Okada, T.; Kenmoku, H.; Toyota, M.; Asakawa, Y. De novo sequencing and transcriptome analysis of the central nervous system of mollusc Lymnaea stagnalis by deep RNA sequencing. PLoS ONE 2012, 7, e42546. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Waititu, J.K.; Zhang, C.; Liu, J.; Wang, H. Plant Non-Coding RNAs: Origin, Biogenesis, Mode of Action and Their Roles in Abiotic Stress. Int. J. Mol. Sci. 2020, 21, 8401. [Google Scholar] [CrossRef] [PubMed]
  49. Chase, M.W.; Reveal, J.L.; Fay, M.F. A subfamilial classification for the expanded asparagalean families Amaryllidaceae, Asparagaceae and Xanthorrhoeaceae. Bot. J. Linn. Soc. 2009, 161, 132–136. [Google Scholar] [CrossRef] [Green Version]
  50. Liu, Q.; Luo, L.; Zheng, L. Lignins: Biosynthesis and Biological Functions in Plants. Int. J. Mol. Sci. 2018, 19, 335. [Google Scholar] [CrossRef] [Green Version]
  51. Shang, H.; Zhang, N.; Xie, Z.; Deng, S.; Yi, L.; Huang, X. Genome-Wide Identification and Expression of the PIN Auxin Efflux Carrier Gene Family in Watermelon (Citrullus lanatus). Agriculture 2021, 11, 447. [Google Scholar] [CrossRef]
  52. Bottani, S.; Zabet, N.R.; Wendel, J.F.; Veitia, R.A. Gene Expression Dominance in Allopolyploids: Hypotheses and Models. Trends Plant Sci. 2018, 23, 393–402. [Google Scholar] [CrossRef]
Agriculture 12 01003 g001 550
Figure 1. Sequence length distribution and function annotation of A. angustifolia unigenes and their closest homologs in the species of the Nr results.
Figure 1. Sequence length distribution and function annotation of A. angustifolia unigenes and their closest homologs in the species of the Nr results.
Agriculture 12 01003 g001
Agriculture 12 01003 g002 550
Figure 2. GO and KEGG classifications of the assembled unigenes in Agave angustifolia.
Figure 2. GO and KEGG classifications of the assembled unigenes in Agave angustifolia.
Agriculture 12 01003 g002
Agriculture 12 01003 g003 550
Figure 3. The maximum phylogenetic tree of CAD proteins in amborella (Atr, black), arabidopsis (At, green), rice (Os, blue), asparagus (Ao, yellow), A. deserti (Ad, pink), A. tequilana (Aq, crimson), A. americana (Am, purple), A. hybrid H11648 (Ah, red) and A. angustifolia (Ag, celeste).
Figure 3. The maximum phylogenetic tree of CAD proteins in amborella (Atr, black), arabidopsis (At, green), rice (Os, blue), asparagus (Ao, yellow), A. deserti (Ad, pink), A. tequilana (Aq, crimson), A. americana (Am, purple), A. hybrid H11648 (Ah, red) and A. angustifolia (Ag, celeste).
Agriculture 12 01003 g003
Agriculture 12 01003 g004 550
Figure 4. Expression analysis of agave CAD genes by RNA-Seq (A), qRT-PCR (B) and correlation analysis of the two methods (C). Grey squares without numbers represent no data obtained by RNA-Seq. The clusters of genes and species were calculated by the hierarchical clustering method in A and B [46].
Figure 4. Expression analysis of agave CAD genes by RNA-Seq (A), qRT-PCR (B) and correlation analysis of the two methods (C). Grey squares without numbers represent no data obtained by RNA-Seq. The clusters of genes and species were calculated by the hierarchical clustering method in A and B [46].
Agriculture 12 01003 g004
Table
Table 1. Conserved primers used for qRT-PCR analysis in five agave species.
Table 1. Conserved primers used for qRT-PCR analysis in five agave species.
Gene IDForward PrimerReverse PrimerProduct Size (bp)
CAD1TGAGATCACCGGCATAATCATCTGTCAGCAACCAGCATTC223
CAD2GACGCCTACTTGGTCAGCTCGAACTGCATTGGCTGATTGA171
CAD3TTGCAGTCAAGTTTGGCAAGTTGAGCAACTGCAGAATTGG214
CAD4TCAGTACAAGCGCATCCAAGACCCCACCAACTTTCAACAG181
CAD5CAAAAGAGAACGGGAAGCAGTGCTGTGAAGGTCTGAGTGG183
CAD6TGGGATGAAGGTGACAGTGAAAAAGATCAACGGCACAAGG182
CAD7TGTCACCGAAGTAGGCACTGAATCCATAGGCAAGGTGTCG248
PP2ACCTCCTCCTCCTTCGGTTTGGCCATGAATGTCACCGCAGA235
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Huang, X.; Xu, B.; Tan, S.; Huang, Y.; Xi, J.; Qin, X.; Chen, T.; Chen, H.; Yang, X.; Yi, K. Transcriptome Sequencing of Agave angustifolia Reveals Conservation and Diversification in the Expression of Cinnamyl Alcohol Dehydrogenase Genes in Agave Species. Agriculture 2022, 12, 1003. https://doi.org/10.3390/agriculture12071003

AMA Style

Huang X, Xu B, Tan S, Huang Y, Xi J, Qin X, Chen T, Chen H, Yang X, Yi K. Transcriptome Sequencing of Agave angustifolia Reveals Conservation and Diversification in the Expression of Cinnamyl Alcohol Dehydrogenase Genes in Agave Species. Agriculture. 2022; 12(7):1003. https://doi.org/10.3390/agriculture12071003

Chicago/Turabian Style

Huang, Xing, Bochao Xu, Shibei Tan, Yanlei Huang, Jingen Xi, Xu Qin, Tao Chen, Helong Chen, Xiaohan Yang, and Kexian Yi. 2022. "Transcriptome Sequencing of Agave angustifolia Reveals Conservation and Diversification in the Expression of Cinnamyl Alcohol Dehydrogenase Genes in Agave Species" Agriculture 12, no. 7: 1003. https://doi.org/10.3390/agriculture12071003

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop