The Influencing Mechanisms of Reclaimed Water on N₂O Production in a Multiyear Maize–Wheat Rotation

Abstract

Reclaimed water (RW) is widely used in agricultural systems; however, it affects soil properties and the surrounding environment, thus influencing soil nitrogen transformation and increasing N₂O and NO emissions. Understanding the influencing mechanism of N₂O production in RW-irrigated soil is very important for water resource utilization and environmental protection, but it is rarely studied. This study investigated the impact of three nitrogen ions (NH₄⁺, NO₃⁻, NO₂⁻) on the nitrogen transformation process and non-biological processes affecting NO and N₂O emissions from soil under multiyear RW-irrigated conditions. The results showed that RW effectively increased the abundance of nitrifying and denitrifying functional genes, leading to a significant increase (p < 0.05) in soil NO and N₂O emissions under ammonium treatment. Furthermore, RW can reduce the cumulative NH₃ emission by 19.11% compared to deionized water (DW). In nitrate treatment, RW can significantly increase (p < 0.05) the nitrate conversion rate by increasing the abundance of denitrifying genes, but not significantly enhance N₂O and NO emissions. In NO₂⁻ oxidation, RW could increase the abundance of nitrifying genes (AOA-amoA, AOB-amoA), thereby promoting the progression of nitrifier denitrification and leading to a substantial increase (p < 0.05) in soil N₂O production. In summary, RW irrigation primarily increases N₂O emissions from soil by enhancing soil autotrophic nitrification and heterotrophic nitration. To effectively control soil N₂O emissions under agricultural irrigation with RW, it is crucial to carefully manage soil nitrification and adjust the ratio of ammonium and nitrate in the soil.

1. Introduction

As urban areas continue to expand, the quality of RW, commonly utilized in agriculture and present in rivers, differs from that of conventional water [1,2,3]. The growing prevalence of RW irrigation has raised significant concerns about its safety in application. Concerning soil properties, numerous researchers have observed that RW could have an impact on soil electrical conductivity (EC), pH, soil nitrogen content (soil N), soil porosity, soil microorganisms, and more [4,5]. Amidst the growing prominence of global warming and water scarcity, agriculture, which serves as a significant contributor to greenhouse gas emissions, has garnered widespread attention. In this context, the shifts in agricultural irrigation water quality have gradually emerged as a focal point. Zou et al. [6] observed elevated N₂O emissions from rice paddies with sewage water irrigation. Chi et al. [7] noted that RW irrigation significantly influenced soil N₂O emissions during multiple maize–wheat rotations. In 2017, Xu et al. [8] also reported a significant increase in soil CO₂ and N₂O emissions due to sewage irrigation. These studies solely concentrated on the effects of RW irrigation on soil N₂O emissions, without delving into the underlying impact mechanism.

Nitrous Oxide (N₂O): an essential atmospheric greenhouse gas and a principal gaseous product generated during agricultural production management [9,10,11]. It is directly related to soil nitrogen transformation. According to the types of nitrogen forms involved in nitrogen transformation, nitrogen forms can be generally classified into three categories: NH₄⁺ oxidation, NO₃⁻ reduction, and NO₂⁻ oxidation and reduction [12,13]. These soil nitrogen transformation processes could be impacted by soil properties and soil microorganisms. For example, soil EC could inhibit soil nitrification to reduce N₂O emissions [14]. Nitrifier denitrification could be significantly increased in acidic environments [12]. Nitrifying (AOA-amoA and AOB-amoA) and denitrifying (nirK, nirS, and nosZ) microorganisms could directly determine the process of nitrogen transformation. While limited research has investigated the mechanism behind N₂O emissions from soil under RW irrigation, there are still other research findings that can offer a reasonable explanation for the influence of adding RW on soil gas emissions. Qian et al. [15] considered that RW irrigation can effectively elevate Na⁺ and soil N levels. Xu et al. [16] also demonstrated that prolonged RW irrigation results in increased soil nitrogen content. Guo et al. [17] indicated that RW affects soil nitrogen ion content and the microbial community, leading to improved soil bacterial activity. Ndour et al. [18] highlighted the benefits of RW for nitrifying and denitrifying bacterial communities and their activities. Hu et al. [1] also posited that RW can flexibly enhance the abundance of denitrification microorganisms. Although these research findings provide some guidance in understanding the mechanism by which RW irrigation affects soil N₂O emissions, the specific soil nitrogen conversion process affected by RW irrigation remains unknown to us. Most studies have identified a peak in N₂O emissions following fertilizer application [10,19]. The reasons for this lie in the fact that the forms of nitrogen ions can significantly impact nitrogen transformation in the soil, thereby influencing N₂O and NO emissions. Wunderlin et al. [12] employed various forms of nitrogen to investigate the mechanism of N₂O production in biological wastewater treatment under nitrification and denitrification conditions.

This paper conducted an indoor cultivation experiment to assess the impact of RW on soil nitrogen transformation, N₂O, and NO emissions. This was achieved by manipulating three soil nitrogen ions (NH₄⁺, NO₃⁻, NO₂⁻) along with two types of water (RW and DW). Additionally, the study evaluated non-biological soil nitrogen transformation processes under RW irrigation through high-temperature and chemical sterilization. The findings offer foundational insights into mitigating N₂O emissions from soil under RW irrigation and provide guidance for fertilization practices in the context of long-term RW irrigation.

2. Materials and Methods

2.1. Experimental Design

The trial focused on the patterns of N₂O and NO emissions under RW irrigation with different nitrogen ions and determined the impact of RW on the soil environment. Therefore, the study set up two types of groups: abiotic and transformational groups. The details are depicted in Figure 1.

(1)

the abiotic groups

The abiotic groups, to which 200 N mg kg⁻¹ NaNO₂ was added, included DW, RW, and high-temperature sterilization of RW and DW at 105 °C for 1 h. The soil samples encompassed two distinct categories: regular soil samples and sterilized soil samples. The regular soil samples were derived from a field that had been subjected to extensive rotation between summer maize and winter wheat crops across several years. Conversely, the sterilized soil samples were treated with an addition of 33,800 mg HgCl₂ kg⁻¹ to the regular soil, aiming to efficiently quell the metabolic activity of microorganisms [20]. The abbreviations are (1) regular soil sample with DW (DNI); (2) regular soil sample with RW (RNI); (3) sterilized soil sample with high-temperature sterilization of RW (RWT); and (4) sterilized soil sample with high-temperature sterilization of DW (DWT). The purpose of the control groups was to analyze the effects of RW on soil abiotic processes.

(2)

the transformational groups

The transformational groups were irrigated using RW and DW, and all treatments were divided into three parts according to the addition of different nitrogen ions. The first was NH₄⁺ oxidation, in which the nitrogen provided was NH₄⁺; the second was NO₃⁻ reduction, in which the nitrogen provided was NO₃⁻; and the third was NO₂⁻, in which the nitrogen provided was NO₂⁻. The ammonium treatment (AN), (NH₄)₂SO₄, aimed to analyze the effect of RW on nitrification; the nitrate treatment (KN), KNO₃, was used to analyze denitrification; and the nitrite treatment (NI), NaNO₂, represented the key process for nitrogen transformation to produce N₂O and NO. The abbreviations are (1) AN with RW (RAN) and AN with DW (DAN); (2) KN with RW (RKN) and AN with DW (DKN); (3) NI with RW (RNI) and AN with DW (DNI); and (4) no fertilizer with RW (R0) and no fertilizer with DW (D0). All treatments are listed on

Table 1. The experimental treatments.

Groups	Abbreviation	Nitrogen	Soil	Water Quality	Notes
abiotic groups	RWT	NaNO2	sterilized	RW	The added amount is 200 N mg kg−1
	DWT	NaNO2	sterilized	DW	The added amount is 200 N mg kg−1
transformational groups	RNI	NaNO2	Regular	RW	The added amount is 200 N mg kg−1; serving as a control treatment for non-biological groups
	DNI	NaNO2	Regular	DW
	RAN	(NH4)2SO4	Regular	RW	The added amount is 200 N mg kg−1
	DAN	(NH4)2SO4	Regular	DW	The added amount is 200 N mg kg−1
	RKN	KNO3	Regular	RW	The added amount is 200 N mg kg−1
	DKN	KNO3	Regular	DW	The added amount is 200 N mg kg−1
	R0	/	Regular	RW	As a control treatment for transformational groups
	D0	/	Regular	DW

Note: NaNO₂ means sodium nitrite; (NH₄)₂SO₄ means ammonium sulfate; KNO₃ means potassium nitrate; sterilized means sterilized; Regular means no sterilized soil; RW means reclaimed water; DW means deionized water.

.

2.2. Soil Sample Collection

The soil was collected at depths of 0–30 cm from a field experiment that had been cultivated with six years of summer maize and winter wheat rotation as described by [7]. An experiment was carried out to research the effect of RW on greenhouse gas emissions from soil from 2013 to 2016. The soil in the DW treatments was collected from a multiyear groundwater-irrigated field, and the soil in the RW treatments was collected from a multiyear RW-irrigated treatment field, the sampling depth was 0–20 cm, and the soil type was clay loam. The properties of the soil and water are shown in

Table 2. The properties of RW and soil.

Index	RW	DW	Soil–DW	Soil–RW
CODcr (mg L−1)	41.23 ± 2.23	0	/	/
BOD5 (mg L−1)	8.23 ± 5.23	0	/	/
NH4+-N (mg kg−1)	7.21 ± 3.62	0	1.21 ± 0.12	0.81 ± 0.25
NO3−-N (mg kg−1)	13.64 ± 4.12	0	9.12 ± 0.74	13.23 ± 0.37
SS (mg·L−1)	11.23 ± 3.35	0	/	/
TN	0.03 ± 4.61	0	3.33 ± 0.14	4.01 ± 1.22
NO2−-N (mg kg−1)	4.2 ± 0.42	0	0.56 ± 0.02	0.85 ± 0.14
pH	7.10 ± 0.2	7.10 ± 0.00	7.82 ± 0.31	7.73 ± 0.11
EC	812.57 ± 21.12	23.74 ± 21.12	621.34 ± 32.32	812.34 ± 17.11
SOM (g kg−1)	/	/	17.59 ± 3.21	20.70 ± 1.32

Note: Soil–DW means soil samples irrigated with groundwater for a long time; soil–RW means soil samples irrigated with RW for a long time; COD_cr means chemical oxygen demand; BOD₅ means biochemical oxygen demand; SS means suspended solids; EC means electrical conductivity; SOM means soil organic matter. TN means soil total Nitrogen. The unit for Total Nitrogen (TN) in water is expressed as mg kg⁻¹, while in soil it is expressed as g kg⁻¹.

. The soil bulk densities were 1.39 g cm⁻³ (DW) and 1.41 g cm⁻³ (RW); the field capacities were 21.23% (DW) and 22.31% (RW). Six soil samples in replicated pots for each treatment were collected, air-dried, sieved through a 2.0 mesh, and then homogenized thoroughly and stored at 4 °C prior to the establishment of the microcosm incubation.

2.3. Incubation Process

The incubation experiment, carried out at the College of Water Resources and Civil Engineering, Chinese Agricultural University, was a disturbed soil experiment. For each experiment 30 g of air-dried soil was measured out and transferred into a 250 mL butyl stopper culture flask. A needle tube was used to titrate DW and RW evenly into the soil, achieving a soil WFPS of 40%. The soil was weighed every day, and DW and RW were added to maintain the WFPS value. All treatments were placed in an incubator for 7 days under full shade and darkness conditions before nitrogen ions were added. The culture temperature was maintained at 28 °C to activate microorganisms and to consume ammonium. After 7 days, 3.03 g of water was added to dissolve NH₄⁺, NO₃⁻, and NO₂⁻; the nitrogen content was 200 mg kg⁻¹, and the soil WFPS was set to 70%.

2.4. Measurement of Gas and Soil Nitrogen Levels

N₂O and NO were collected from headspace gas samples at 1, 2, 3, 4, 5, 7, 13, 18, 23, and 28 d of incubation. The sample bottle was ventilated for 2 h before gas was sampled. A 20 mL headspace gas sample was collected before the bottles were sealed, and a second gas sample was collected after the bottle had been sealed for 24 h. When conducting NO concentration testing, 20 mL of detection gas was combined with 980 mL of helium in a 1 L sampling bag to facilitate the passage of a 1 L gas volume through the system. N₂O was analyzed via gas chromatography (Agilent GC-6820, Agilent Technologies Inc., Santa Clara, CA, USA). The NO sample was measured with a model 42i chemiluminescence NO–NO–NO_X analyzer (Thermo Environmental Instruments Inc., Franklin, MA, USA). Every treatment was performed with three replicates. The cumulative gas was the sum of the daily concentrations, and the unmonitored values were calculated from the adjacent differences.

$$F=\frac{M_0}{22.4}\frac{273}{273+T}\frac{P_0}{p}\frac{1}{M}\times V\times 24$$

(1)

where M₀ is the mass fraction of N in N₂O and NO, P₀ is the standard atmospheric pressure, V is the volume of the headspace gas sample, M is the quality of the soil, and T is the temperature of the bottle.

NH₄⁺, NO₃⁻, and NO₂⁻ were analyzed using a flow analyzer (Alliance Futura, AMS, Frépillon, France), and the sample times were 1, 3, 5, 7, 13, 18, 23, and 28 d. The soil potential denitrification rate (PDR) was evaluated via nitrate reduction in DKN and RKN, as shown in Formula (1) [21]. The soil potential nitrite oxidation (PNO) occurred via nitrite reduction in DNI and RNI, and the rates were calculated from the linear decrease and were taken as the PNO, as shown in Formula (2) [22].

$$PDR=\frac{(200-{(C}_{{\mathrm{N}\mathrm{O}}_3^{-}}^N+C_{{\mathrm{N}\mathrm{O}}_3^{-}}^{con}))}{d}$$

(2)

$$PNO=\frac{(200-C_{{\mathrm{N}\mathrm{O}}_2^{-}}^N)}{d}$$

(3)

where $C_{{\mathrm{N}\mathrm{O}}_3^{-}}^N$ is the content of NO₃⁻ at the end of the incubation (mg/kg), $C_{{NO}_3^{-}}^{con}$ is the content of NO₃⁻-N in the control group (mg/kg), and d is the incubation time of soil samples in the solution.

The soil pH and EC were measured using a Doppler multiparameter tester (SG23, Mettler Toledo, Shanghai, China) after cultivation according to the methods of [23].

2.5. Real-Time PCR

On the final day of the incubation, soil samples of all treatments were collected and used for DNA extraction and quantitative PCR analysis (qPCR). Genes from nitrifying bacteria included ammonia-oxidizing archaea (AOB-amoA) and bacteria (AOB−amoB). Genes from denitrifying bacteria included the nirK, nirS, and nosZ. All of these bacteria were used to target N₂O producers. The real-time PCR method used in this paper was described by [22]. The primer-extension strategy is outlined in

Table 3. List of amplified sequences of genes related to soil nitrification and denitrification microorganisms.

Gene	F	F- Gene Sequence	R	R- Gene Sequence
AOA	amoAF	STAATGGTCTGGCTTAGACG	amoAR	GCGGCCATCCATCTGTATGT
AOB	bamoA1F	GGGGTTTCTACTGGTGGT	bamoA2R	CCCCTCKGSAAAGCCTTCTTC
nosZ	1126F	GGGCTBGGGCCRTTGCA	1381R	GGGCTBGGGCCRTTGCA
nirK	FLaCuF	ATCATGGTSCTGCCGCG	R3CuR	GCCTCGATCAGRTTGTGGTT
nirS	cd3aF	GTSAACGTSAAGGARACSGG	R3cdR	GASTTCGGRTGSGTCTTGA
NOB	NSR1113	CCTGCTTTCAGTTGCTACCG	NSR1264	GTTTGCAGCGCTTTGTACCG

.

2.6. Data Analysis and Statistical Analyses

Analysis of the main effects was performed using SPSS V25 for Windows (SPSS Inc., Chicago, IL, USA) to determine the treatment effects. Simple effect analysis was further conducted when significant interactions were observed. The least significant difference procedure (LSD) and a probability level of 0.05 were used to determine significant differences between treatment means. In this study, ‘average’ refers to the arithmetic mean.

3. Results

3.1. The N₂O Emission under Abiotic Groups

Upon analyzing the influence of non-biological processes on soil NO and N₂O, as shown in Figure 2, the highest N₂O and NO fluxes were observed on the initial day of incubation under the RWT treatment. The results revealed a significant discrepancy in cumulative N₂O emission flux between RWT (178.94 μg kg⁻¹) and DWT (67.04 μg kg⁻¹). Additionally, Figure 2 indicated that RWT did not lead to an increase in NO emissions compared to DWT.

Upon comparing and analyzing the emissions of N₂O and NO from sterilized and non-sterilized soil, a significant difference (p < 0.05) was observed in N₂O and NO flux, as depicted in Figure 2. It was found that non-biological cumulative N₂O emissions constituted 25.76% of the total soil N₂O emissions under RW, whereas under DW, non-biological cumulative N₂O emissions accounted for 14.06% of the total soil N₂O emissions. Similarly, non-biological NO emissions represented 25.54% of the total soil NO emissions under RW, while under DW, non-biological NO emissions accounted for 10.36% of the total soil NO emissions.

3.2. N₂O Production during NH₄⁺ Oxidation under RW Irrigation

Regarding N₂O emissions, the peak values of N₂O emissions were detected on the fourth and fifth days of incubation, and the peak was one day ahead of that in DAN (Figure 3a). The peak value of N₂O in RAN was 2162.77 ng kg⁻¹ h⁻¹, and the value increased by 17.61% in comparison to DAN.

Table 4. Average N₂O and NO emissions.

Treatments		Average N2O (μg kg−1 d−1)	Average NO (μg kg−1 d−1)	Nitrogen Conversion (mg kg−1 d−1)	Y-N (%)
NH4+ oxidation	RAN	20.79 ± 0.43 Bb	0.37 ± 0.02 Bb	4.23	0.44
	DAN	16.93 ± 2.04 Ba	0.33 ± 0.02 Ba	4.67	0.37
NO3− reduction	RKN	06.04 ± 0.64 Aa	0.14 ± 0.04 Aa	1.44	0.43
	DKN	05.09 ± 0.85 Aa	0.11 ± 0.01 Aa	0.93	0.56
NO2− oxidation	RNI	15.18 ± 1.15 Cb	0.24 ± 0.03 Ba	3.87	0.35
	DNI	10.48 ± 1.31 Ca	0.19 ± 0.02 Ba	4.41	0.24

Y-N was calculated by dividing the average N₂O + NO emission rate by the nitrogen conversion rate and multiplying by 100%. Nitrogen conversion was calculated via regression analysis.

also indicated that the average N₂O in RAN was significantly higher than that in DAN. Regarding NO emissions, as illustrated in Figure 3a, NO emissions first increased and then decreased during the cultivation period. The peak NO values in the DAN and RAN treatments were 211.39 ng kg⁻¹ h⁻¹ and 151.13 ng kg⁻¹ h⁻¹, respectively, observed on the third day of incubation. Table 4 also showed that the average NO emission in RAN was significantly (p < 0.05) higher than that in DAN.

The N₂O and NO emissions were impacted by soil nitrogen content. As shown in Figure 3b, the concentration of the NO₃⁻ ion increased with decreasing NH₄⁺ ions, and the NH₄⁺ conversion in RW was significantly higher than that in DW (Table 4). The peak concentration of NO₂⁻ was detected on the third day of incubation, and it was found that the peak concentration in the RAN treatment was higher than that in the DAN treatment. Furthermore, the peak time of NO₂⁻ coincided with the peak in NO flux.

When comparing the abundance of nitrogen transformation genes between RW and DW, the findings indicated that under NH₄⁺ oxidation conditions, RW could significantly enhance the abundance of nitrifying functional genes and gene-nirS compared to DW (p < 0.05). However, the abundance levels of gene-nirK and gene-nosZ showed no significant difference between RAN and DAN, as illustrated in Figure 3c.

3.3. N₂O Production during NO₃⁻ Reduction under RW Irrigation

In the context of NO₃⁻ reduction, both N₂O and NO exhibit a decrease in emissions over the incubation period. Specifically, the highest NO emissions were observed on the second day of incubation, as depicted in Figure 4a. The peak NO emission rate for RKN was 64.76 ng kg⁻¹ h⁻¹, while for DKN it was 42.37 ng kg⁻¹ h⁻¹. As for N₂O emissions, the peak rate for RKN occurred on the third day, whereas for DKN it was on the fourth day. The peak N₂O emission rate for RKN was 423.7 ng kg⁻¹ h⁻¹, whereas for DKN it was 363.53 ng kg⁻¹ h⁻¹.

Over the incubation period, there was a decline in NO₃⁻ levels corresponding to the duration of incubation. The peak NO₂⁻ value aligned with the highest NO emissions value in Figure 4b, occurring on the second day of incubation. Furthermore, Figure 4c indicates that the utilization of RW led to a noteworthy increase in the abundance of genes related to NOB, AOA-amoA, nirS, and nosZ.

3.4. N₂O Production during NO₂⁻ Oxidation under RW Irrigation

NO₂⁻ serves as an intermediate product in the nitrification and denitrification processes, and existing research generally indicates that nitrite can effectively elevate N₂O and NO emissions [24,25]. As shown in Figure 5a, the zenith of NO and N₂O emissions occurred on the initial day and subsequently declined sharply. Specifically, the peak NO flux values in the RNI and DNI treatments were recorded as 191.76 ng kg⁻¹ h⁻¹ and 151.97 ng kg⁻¹ h⁻¹, respectively. Similarly, the peak N₂O flux values in the RNI and DNI treatments were observed as 2783.52 ng kg⁻¹ h⁻¹ and 1427.95 ng kg⁻¹ h⁻¹, respectively. Notably, RNI treatment led to a significant augmentation of N2O emissions when compared to DNI (p < 0.05) (Table 4).

As shown in Figure 5b, most of the NO₂⁻ was oxidized into NO₃⁻ ions in RNI and DNI; the content of soil nitrite in DNI was 0 on the 5th day, and that in RNI was 0 until the 18th day of incubation. The abundance of soil microorganisms in nitrifying and denitrifying soils was similar to that in NH₄⁺ oxidation (Figure 5c). RW significantly (p < 0.05) increased nitrifying functional gene abundance (Figure 5c).

3.5. The Transformation of Soil Nitrogen and Its Properties

As shown in Figure 6, both PDR and PNO exhibited a similar trend of variation, reaching their peak values on the third day after nitrogen application and subsequently declining as the incubation period progressed. Notably, significant discrepancies emerged on the third day across different water qualities (p > 0.05). Table 4 clearly illustrates that NH₄⁺ and NO₂⁻ transformations under RW were lower than under DW, while the NO₃⁻ transformation in RW was higher than in DW.

In terms of soil properties, the soil pH demonstrated a decrease after cultivation following the application of nitrogen. The pH of the soil treated with DW was found to be higher compared to that of RW; however, no significant difference was observed between the various water quality treatments. The EC value of RW was significantly higher (p < 0.01) than that of DW. The EC value for RW was between 900 and 1100 μs cm⁻¹, while for DW it ranged between 700 and 800 μs cm⁻¹. No significant difference was observed among the various nitrogen application treatments (p > 0.05), and the EC value in RNI exhibited the smallest value.

4. Discussion

Soil chemical denitrification is a prominent non-biological reaction process responsible for soil N₂O and NO production. Previous research has highlighted that soil chemical denitrification predominantly encompasses the chemical decomposition of NO₂⁻ either on its own or in conjunction with other compounds (such as Fe²⁺, Cu²⁺, phenolic compounds, humus, etc.), yielding readily decomposable chemical substances. Consequently, this process gives rise to NO_x, N₂O, and N₂ gases [26]. In summary, the potency of chemical denitrification is predominantly influenced by the buildup of NO₂⁻. As exemplified by research on sandy loam soil, chemical denitrification accounted for 6.7% to 12.7% of soil NO emissions across various nitrogen application scenarios [27]. This finding aligns with the outcomes observed in our DW treatment. The heightened contribution of the non-biological reactions of soil to N₂O/NO emissions under RW irrigation treatment primarily results from variations in soil organic matter content and soil pH. Some studies have indicated that an elevation in soil organic matter content [28] and a reduction in soil pH [29] contribute to enhancing the abiotic process of soil N₂O production.

N₂O is produced in the NH₄⁺ environment through the conversion of NH₃ to NH₂OH [28] or the oxidation of NH₂OH through nitrification [30,31]. Consequently, NO₂⁻ denitrification and nitrifier denitrification processes contribute to N₂O formation. Our study had considered that RW could increase the average N₂O and NO flux during the NH₄⁺ and NO₂⁻ incubation period. The results were consistent with certain DW experiments [6,32,33]. Fan et al. [25] observed an increase in N₂O and NO emissions with higher NO₂⁻ content. Similarly, Shang et al. [34] demonstrated that RW with NH₄⁺ led to greater N₂O emissions compared to NO₃⁻. Therefore, we consider that RW could effectively improve the contribution of soil nitrification and nitrifier denitrification on N₂O production. This phenomenon is primarily attributed to alterations in soil microorganisms associated with nitrogen transformation. Our study, along with similar findings [3,17], observed that irrigation with RW could indeed enhance the abundance levels of nitrifying and denitrifying microorganisms in the soil. In this study, RW increases the AOB-amoA abundance in RNI and RAN in comparison with DNI and DAN, respectively (Figure 2 and Figure 4c). Wunderlin et al. [12] proposes that the production of NO, a precursor to N₂O in the nitrogen reduction chain, underscores nitrifier denitrification by AOB to be the dominant N₂O production pathway. A higher nitrite content leads to increased nitrifier denitrification activity by AOB with nitrite instead of oxygen as the terminal electron acceptor [35,36]. Apart from the alteration in soil microorganisms, shifts in the soil environment can also expedite the transformation of soil NO₂⁻. As shown in Figure 5c, the pH in RNI was lower than that in DNI at the end of the incubation. This condition maybe beneficial to soil nitrifier denitrification activity. Wang et al. [37] considers that a high N content and low pH could result in nitrite denitrification. Studies [38,39] have also shown that the type and rate of fertilizer application can significantly impact denitrification. These resulted in higher N₂O emissions under the RAN and RNI treatments compared to the DAN and DNI treatments. However, in our study, it was observed that while RW effectively increased soil N₂O and NO under AN and NI treatments, NH₄⁺ and NO₂⁻ transformations under RW were lower than under DW (Table 4). This could be attributed to the presence of nitrogen in RW, which might influence the conversion processes of NH₄⁺ and NO₂⁻ in the soil. Furthermore, this study employed three conditions to estimate the pathways of N₂O production; however, these conditions may not fully represent heterotrophic nitrification. As indicated in Table 1, the soil organic carbon (SOC) content in RW was higher than that in DW, which could potentially lead to an increase in heterotrophic nitrification in the RW treatment. Further investigation of the related content can be conducted based on the presence of ¹⁵N isotopes, as demonstrated in previous studies [6,8,28]. After analyzing the effect of the KN treatment, the results suggest that there was no significant difference between RW and DW. While RW could increase the abundance of denitrifying genes, it does not have a significant impact on the process of denitrification and N₂O production in this study. However, the contribution of denitrification to N₂O production remains uncertain. To gain further clarity, additional investigations such as determining soil N₂ emissions or employing the ¹⁵N isotope method should be considered.

5. Conclusions

NH₄⁺ and NO₂⁻ play a pivotal role in the escalation of soil N₂O and NO emissions. RW has demonstrated its capacity to augment the abundance of nitrifying genes and nirS across varying nitrogen ions. The influence of RW extends to the enhancement of N₂O and NO emissions through strengthening processes such as nitrification, nitrite denitrification, and the abiotic process. Significantly, RW amplifies its influence on soil nitrogen loss through the enhancement of the denitrification process. However, this augmentation may not necessarily yield a pronounced surge in N₂O emission during denitrification. Alternatively, judicious elevation of nitrate content can effectively regulate both N₂O and NO emissions.