A Highly Glyphosate-Resistant EPSPS Mutant from Laboratory Evolution
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, and Materials
2.2. Plasmid Construction
2.3. ALE Experiments
2.4. Evaluation of Glyphosate Tolerance
2.5. EPSP Synthase Assay
2.6. Bioinformatics Analysis
3. Results
3.1. Isolated Evolved Mutants Exhibit a Significant Increase in Glyphosate Tolerance
3.2. Kinetic Parameters of the GR79(Y40I)-EPSPS Mutant
3.3. Bioinformatic Analysis of GR79(Y40I)-EPSPS
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kishore, G.M.; Shah, D.M. Amino Acid Biosynthesis Inhibitors as Herbicides. Annu. Rev. Biochem. 1988, 57, 627–663. [Google Scholar] [CrossRef] [PubMed]
- Shikimic Acid; Metabolism and Metabolites. Int. J. Biochem. 1994, 26, 855. [CrossRef]
- Firdous, S.; Iqbal, S.; Anwar, S.; Jabeen, H. Identification and Analysis of 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS) Gene from Glyphosate-Resistant Ochrobactrum Intermedium Sq20: Identification of EPSPS from Ochrobactrum Intermedium SqPest. Manag. Sci. 2018, 74, 1184–1196. [Google Scholar] [CrossRef]
- Brunharo, C.A.; Patterson, E.L.; Carrijo, D.R.; de Melo, M.S.; Nicolai, M.; Gaines, T.A.; Nissen, S.J.; Christoffoleti, P.J. Confirmation and Mechanism of Glyphosate Resistance in Tall Windmill Grass (Chloris Elata) from Brazil: Glyphosate Resistance in Tall Windmill Grass (Chloris Elata) from Brazil. Pest. Manag. Sci. 2016, 72, 1758–1764. [Google Scholar] [CrossRef]
- Alarcón-Reverte, R.; García, A.; Watson, S.B.; Abdallah, I.; Sabaté, S.; Hernández, M.J.; Dayan, F.E.; Fischer, A.J. Concerted Action of Target-Site Mutations and High EPSPS Activity in Glyphosate-Resistant Junglerice (Echinochloa Colona) from California: Glyphosate-Resistant Echinochloa Colona in California. Pest. Manag. Sci. 2015, 71, 996–1007. [Google Scholar] [CrossRef]
- Leino, L.; Tall, T.; Helander, M.; Saloniemi, I.; Saikkonen, K.; Ruuskanen, S.; Puigbò, P. Classification of the Glyphosate Target Enzyme (5-Enolpyruvylshikimate-3-Phosphate Synthase). Bioinformatics 2020, 408, 124556. [Google Scholar]
- Light, S.H.; Krishna, S.N.; Minasov, G.; Anderson, W.F. An Unusual Cation-Binding Site and Distinct Domain–Domain Interactions Distinguish Class II Enolpyruvylshikimate-3-Phosphate Synthases. Biochemistry 2016, 55, 1239–1245. [Google Scholar] [CrossRef]
- Pollegioni, L.; Schonbrunn, E.; Siehl, D. Molecular Basis of Glyphosate Resistance—Different Approaches through Protein Engineering: Mechanisms of Glyphosate Resistance. FEBS J. 2011, 278, 2753–2766. [Google Scholar] [CrossRef] [Green Version]
- Priestman, M.A.; Funke, T.; Singh, I.M.; Crupper, S.S.; Schönbrunn, E. 5-Enolpyruvylshikimate-3-Phosphate Synthase from Staphylococcus Aureus Is Insensitive to Glyphosate. FEBS Lett. 2005, 579, 728–732. [Google Scholar] [CrossRef] [Green Version]
- Funke, T.; Yang, Y.; Han, H.; Healy-Fried, M.; Olesen, S.; Becker, A.; Schönbrunn, E. Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr 97 → Ile and Pro 101 → Ser in 5-Enolpyruvylshikimate-3-Phosphate Synthase from Escherichia Coli. J. Biol. Chem. 2009, 284, 9854–9860. [Google Scholar] [CrossRef] [Green Version]
- Perotti, V.E.; Larran, A.S.; Palmieri, V.E.; Martinatto, A.K.; Alvarez, C.E.; Tuesca, D.; Permingeat, H.R. A Novel Triple Amino Acid Substitution in the EPSPS Found in a High-level Glyphosate-resistantAmaranthus hybridusPopulation from Argentina. Pest. Manag. Sci. 2019, 75, 1242–1251. [Google Scholar] [CrossRef] [PubMed]
- Franci, J.; Lam, K.W.; Chuah, T.S.; Cha, T.S. Genetic Diversity and in Silico Evidence of Target-Site Mutation in the EPSPS Gene in Endowing Glyphosate Resistance in Eleusine Indica (L.) from Malaysia. Pestic. Biochem. Physiol. 2020, 165, 104556. [Google Scholar] [CrossRef] [PubMed]
- Identification of a Glyphosate-Resistant Mutant of Rice 5-Enolpyruvylshikimate 3-Phosphate Synthase Using a Directed Evolution Strategy. Plant Physiol. 2006, 140, 184–195. [CrossRef] [PubMed] [Green Version]
- Mao, C.; Xie, H.; Chen, S.; Valverde, B.E.; Qiang, S. Error-Prone PCR Mutation of Ls-EPSPS Gene from Liriope Spicata Conferring to Its Enhanced Glyphosate-Resistance. Pestic. Biochem. Physiol. 2017, 141, 90–95. [Google Scholar] [CrossRef]
- Tan, X.L.; Othman, R.Y.; Teo, C.H. Isolation and Functional Characterization of 5-Enolpyruvylshikimate 3-Phosphate Synthase Gene from Glyphosate-Tolerant Pseudomonas Nitroreducens Strains FY43 and FY47. 3 Biotech 2020, 10, 183. [Google Scholar] [CrossRef]
- Tian, Y.-S.; Xu, J.; Peng, R.-H.; Xiong, A.-S.; Xu, H.; Zhao, W.; Fu, X.-Y.; Han, H.-J.; Yao, Q.-H. Mutation by DNA Shuffling of 5-Enolpyruvylshikimate-3-Phosphate Synthase from Malus Domestica for Improved Glyphosate Resistance. Plant Biotechnol. J. 2013, 11, 829–838. [Google Scholar] [CrossRef]
- Kaundun, S.S.; Zelaya, I.A.; Dale, R.P.; Lycett, A.J.; Carter, P.; Sharples, K.R.; McIndoe, E. Importance of the P106S Target-Site Mutation in Conferring Resistance to Glyphosate in a Goosegrass (Eleusine Indica) Population from the Philippines. Weed Sci. 2008, 56, 637–646. [Google Scholar] [CrossRef]
- Wakelin, A.M.; Preston, C. Inheritance of Glyphosate Resistance in Several Populations of Rigid Ryegrass (Lolium Rigidum) from Australia. Weed Sci. 2006, 54, 212–219. [Google Scholar] [CrossRef]
- He, M.; Yang, Z.-Y.; Nie, Y.-F.; Wang, J.; Xu, P. A New Type of Class I Bacterial 5-Enopyruvylshikimate-3-Phosphate Synthase Mutants with Enhanced Tolerance to Glyphosate. Biochim. Et Biophys. Acta (BBA)—Gen. Subj. 2001, 1568, 1–6. [Google Scholar] [CrossRef]
- Phaneuf, P.V.; Zielinski, D.C.; Yurkovich, J.T.; Johnsen, J.; Szubin, R.; Yang, L.; Kim, S.H.; Schulz, S.; Wu, M.; Dalldorf, C. and Escherichia Coli Data-Driven Strain Design Using Aggregated Adaptive Laboratory Evolution Mutational Data. ACS Synth. Biol. 2021, 10, 3379–3395. [Google Scholar] [CrossRef]
- Cairns, J.; Overbaugh, J.; Miller, S. The Origin of Mutants. Nature 1988, 335, 142–145. [Google Scholar] [CrossRef] [PubMed]
- Barrick, J.E.; Yu, D.S.; Yoon, S.H.; Jeong, H.; Oh, T.K.; Schneider, D.; Lenski, R.E.; Kim, J.F. Genome Evolution and Adaptation in a Long-Term Experiment with Escherichia Coli. Nature 2009, 461, 1243–1247. [Google Scholar] [CrossRef]
- Blount, Z.D.; Barrick, J.E.; Davidson, C.J.; Lenski, R.E. Genomic Analysis of a Key Innovation in an Experimental Escherichia Coli Population. Nature 2012, 489, 513–518. [Google Scholar] [CrossRef] [PubMed]
- Lenski, R.E. Phenotypic and Genomic Evolution during a 20,000—Generation Experiment with the Bacterium Escherichia Coli. Plant Breed. Rev. 2004, 24, 225–266. [Google Scholar]
- Oliver, A.; Cantón, R.; Campo, P.; Baquero, F.; Blázquez, J. High Frequency of Hypermutable Pseudomonas Aeruginosa in Cystic Fibrosis Lung Infection. Science 2000, 288, 1251–1253. [Google Scholar] [CrossRef]
- Shewaramani, S.; Finn, T.J.; Leahy, S.C.; Kassen, R.; Rainey, P.B.; Moon, C.D. Anaerobically Grown Escherichia Coli Has an Enhanced Mutation Rate and Distinct Mutational Spectra. PLoS Genet. 2017, 13, e1006570. [Google Scholar] [CrossRef]
- Creamer, K.E.; Ditmars, F.S.; Basting, P.J.; Kunka, K.S.; Hamdallah, I.N.; Bush, S.P.; Scott, Z.; He, A.; Penix, S.R.; Gonzales, A.S.; et al. Benzoate- and Salicylate-Tolerant Strains of Escherichia Coli K-12 Lose Antibiotic Resistance during Laboratory Evolution. Appl Env. Microbiol 2017, 83, e02736-16. [Google Scholar] [CrossRef] [Green Version]
- Huang, X.-J.; Du, H.; Deng, X.-L.; Chen, Y.-H.; Xiang, L.; Li, Y.-W.; Li, H.; Mo, C.-H.; Cai, Q.-Y.; Zhao, H.-M. New Insights into the Evolution of Bacterial Community during the Domestication of Phthalate-Degrading Consortium. J. Clean. Prod. 2021, 303, 127064. [Google Scholar] [CrossRef]
- Portnoy, V.A.; Bezdan, D.; Zengler, K. Adaptive Laboratory Evolution—Harnessing the Power of Biology for Metabolic Engineering. Curr. Opin. Biotechnol. 2011, 22, 590–594. [Google Scholar] [CrossRef]
- Cao, G.; Liu, Y.; Zhang, S.; Yang, X.; Chen, R.; Zhang, Y.; Lu, W.; Liu, Y.; Wang, J.; Lin, M.; et al. A Novel 5-Enolpyruvylshikimate-3-Phosphate Synthase Shows High Glyphosate Tolerance in Escherichia Coli and Tobacco Plants. PLoS ONE 2012, 7, e38718. [Google Scholar] [CrossRef] [Green Version]
- Meng, Y.; Tang, Y.; Zhang, X.; Wang, J.; Zhou, Z. Molecular Identification of Keratinase DgokerA from Deinococcus Gobiensis for Feather Degradation. Appl. Sci. 2022, 12, 464. [Google Scholar] [CrossRef]
- Lanzetta, P.A.; Alvarez, L.J.; Reinach, P.S.; Candia, O.A. An Improved Assay for Nanomole Amounts of Inorganic Phosphate. Anal. Biochem. 1979, 100, 95–97. [Google Scholar] [CrossRef]
- Walters, D.E. Enzymes: A Practical Introduction to Structure, Mechanism, and Data Analysis, 2nd Ed; Copeland, R.A., Ed.; John Wiley & Sons: New York, NY, USA.2000, Xvi + 397 Pp. 16 × 24.5 Cm. ISBN 0-471-35929-7. $99. J. Med. Chem. 2002, 45, 5607. [Google Scholar] [CrossRef]
- Fazi, R.; Tintori, C.; Brai, A.; Botta, L.; Selvaraj, M.; Garbelli, A.; Maga, G.; Botta, M. Homology Model-Based Virtual Screening for the Identification of Human Helicase DDX3 Inhibitors. J. Chem. Inf. Model. 2015, 55, 2443–2454. [Google Scholar] [CrossRef] [PubMed]
- Wintrode, P.L.; Miyazaki, K.; Arnold, F.H. Cold Adaptation of a Mesophilic Subtilisin-like Protease by Laboratory Evolution. J. Biol. Chem. 2000, 275, 31635–31640. [Google Scholar] [CrossRef] [Green Version]
- Podracky, C.J.; An, C.; DeSousa, A.; Dorr, B.M.; Walsh, D.M.; Liu, D.R. Laboratory Evolution of a Sortase Enzyme That Modifies Amyloid-β Protein. Nat. Chem. Biol. 2021, 17, 317–325. [Google Scholar] [CrossRef]
- Boocock, M.R.; Coggins, J.R. Kinetics of 5-Enolpyruvylshikimate-3-Phosphate Synthase Inhibition by Glyphosate. Febs Lett. 1983, 154, 127–133. [Google Scholar] [CrossRef] [Green Version]
- Padgette, S.R.; Huynh, Q.K.; Aykent, S.; Sammons, R.D.; Sikorski, J.A.; Kishore, G.M. Identification of the Reactive Cysteines of Escherichia Coli 5-Enolpyruvylshikimate-3-Phosphate Synthase and Their Nonessentiality for Enzymatic Catalysis. J. Biol. Chem. 1988, 263, 1798–1802. [Google Scholar] [CrossRef]
- Stalker, D.M.; Hiatt, W.R.; Comai, L. A Single Amino Acid Substitution in the Enzyme 5-Enolpyruvylshikimate-3-Phosphate Synthase Confers Resistance to the Herbicide Glyphosate. J. Biol. Chem. 1985, 260, 4724–4728. [Google Scholar] [CrossRef]
- Rainio, M.J.; Ruuskanen, S.; Helander, M.; Saikkonen, K.; Saloniemi, I.; Puigbò, P. Adaptation of Bacteria to Glyphosate: A Microevolutionary Perspective of the Enzyme 5-Enolpyruvylshikimate-3-Phosphate (EPSP) Synthase. Microbiology 2020, 13(3), 309–316. [Google Scholar]
- Funke, T.; Han, H.; Healy-Fried, M.L.; Fischer, M.; Schonbrunn, E. Molecular Basis for the Herbicide Resistance of Roundup Ready Crops. Proc. Natl. Acad. Sci. USA 2006, 103, 13010–13015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaundun, S.S.; Dale, R.P.; Zelaya, I.A.; Dinelli, G.; Marotti, I.; McIndoe, E.; Cairns, A. A Novel P106L Mutation in EPSPS and an Unknown Mechanism(s) Act Additively To Confer Resistance to Glyphosate in a South African Lolium Rigidum Population. J. Agric. Food Chem. 2011, 59, 3227–3233. [Google Scholar] [CrossRef] [PubMed]
Name of Primers | Sequences (5′ to 30′) |
---|---|
pETGR79-F | ATGGGTCGCGGATCCGAATTCAT- GTCACATTCTACCTCTAGGTCCC |
pETGR79-R | GTGGTGGTGGTGGTGCTCGAGATA- TACTCCACATGTATTCCAAACTTCT |
pAGR79-F | CCACACCCGTCCTGTGGATCC- ATGTCACATTCTACCTCTAGGTCCC |
pAGR79-R | CTCTCAAGGGCATCGGTCGAC- TTAATTATACTCCACATGTATTCCAAACTT |
Kinetic Constants | GR79-EPSPS | GR79(Y40I)-EPSPS |
---|---|---|
Specific activity (U/mg) | 14.331 ± 0.144 | 17.436 ± 0.379 |
IC50(glyphosate; mM) | 6.8685 ± 1.3785 | 13.995 ± 2.815 |
Km (PEP; μM) | 39.341 ± 3.21 | 22.012 ± 2.673 |
Ki (glyphosate; μM) | 75.360 ± 5.029 | 127.343 ± 14.338 |
Vmax(U/mg) | 9.285 ± 0.223 | 21.406 ± 0.824 |
Ki/Km (PEP) | 1.916 | 5.785 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yuan, Y.; Zhou, Z.; Zhan, Y.; Ke, X.; Yan, Y.; Lin, M.; Li, P.; Jiang, S.; Wang, J.; Lu, W. A Highly Glyphosate-Resistant EPSPS Mutant from Laboratory Evolution. Appl. Sci. 2022, 12, 5723. https://doi.org/10.3390/app12115723
Yuan Y, Zhou Z, Zhan Y, Ke X, Yan Y, Lin M, Li P, Jiang S, Wang J, Lu W. A Highly Glyphosate-Resistant EPSPS Mutant from Laboratory Evolution. Applied Sciences. 2022; 12(11):5723. https://doi.org/10.3390/app12115723
Chicago/Turabian StyleYuan, Yuan, Zhengfu Zhou, Yuhua Zhan, Xiubin Ke, Yongliang Yan, Min Lin, Pengcheng Li, Shijie Jiang, Jin Wang, and Wei Lu. 2022. "A Highly Glyphosate-Resistant EPSPS Mutant from Laboratory Evolution" Applied Sciences 12, no. 11: 5723. https://doi.org/10.3390/app12115723