Next Article in Journal
Evaluation of Malolactic Starters in White and Rosé Winemaking of Moschofilero Wines
Previous Article in Journal
Dynamic Response of a Heavy-Haul Railway Tunnel’s Bottom Structures in Hard Rock
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 12
Issue 11
10.3390/app12115723
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Highly Glyphosate-Resistant EPSPS Mutant from Laboratory Evolution

by
Yuan Yuan
1,
Zhengfu Zhou
2,
Yuhua Zhan
2,
Xiubin Ke
2,
Yongliang Yan
2,
Min Lin
2,
Pengcheng Li
2,
Shijie Jiang
1,
Jin Wang
1,2,* and
Wei Lu
2,*
1
School of Life Science and Engineering, Southwest University of Science and Technology, Mianyang 621010, China
2
Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, China
*
Authors to whom correspondence should be addressed.
Appl. Sci. 2022, 12(11), 5723; https://doi.org/10.3390/app12115723
Submission received: 3 April 2022 / Revised: 30 May 2022 / Accepted: 31 May 2022 / Published: 4 June 2022
Browse Figures
Versions Notes

Abstract

:
EPSP synthase is the target enzyme of glyphosate herbicides. Due to the extensive use of glyphosate, it is very important to obtain EPSPS genes with high glyphosate resistance for the development of transgenic crops. GR79-EPSPS is a class I EPSP synthase with certain glyphosate resistance isolated from glyphosate-contaminated soil. After more than 1000 generations, a Y40I substitution was identified, and the enzyme had a nearly 1.8-fold decrease in Km [PEP] and a 1.7-fold increase in Ki[glyphosate] compared to the wild-type enzyme. Enzyme dynamics and molecular dynamics analysis showed that the substitution was near the hinge region of EPSPS, and the affinity of glyphosate binding to amino acid residues of the active site decreased due to Y40I substitution, resulting in an increase in glyphosate resistance. These results provide more evidence for the combination of directed evolution and rational design of protein engineering.

1. Introduction

5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19), which mainly exists in fungi, bacteria, algae and higher plants [1,2], catalyzes the penultimate step reaction in the shikimic acid pathway. EPSPS is a key enzyme in the process of synthesizing aromatic amino acids (phenylalanine, tyrosine and tryptophan) and in the production of some secondary metabolites, such as phenols, lignin and other phenylalanines [1,2,3]. This enzyme is the target enzyme of nonselective glyphosate (GLP) herbicide, which is widely used as the main tool for weeding orchards, pastures and genetically modified glyphosate-resistant crops worldwide because of its simple and convenient use, broad spectrum, flexibility, low price and easy decomposition in the environment [4,5].
Four types of EPSPS have been classified according to a new bioinformatic classification method [6] based on the presence and absence of amino acid markers in the active site [3,7,8,9,10]. Species, including class I EPSPS sequences (Iα and Iβ), are sensitive to glyphosate, while species containing class II sequences tend to be resistant to glyphosate. EPSPS belonging to Classes III and IV may be resistant to glyphosate and are relatively rare in nature (<5% of the sequences) [6]. To date, most commercial glyphosate-tolerant (GT) crops use a Class II EPSPS gene from Agrobacterium sp. CP4 due to high glyphosate tolerance. Apart from screening glyphosate-tolerant EPSPS from bacteria that live in a glyphosate-contaminated environment [11,12], mutagenesis of EPSPS is another way to obtain glyphosate-tolerant EPSPS.
In recent years, researchers have modified existing enzymes through various biological methods to change their catalytic characteristics and substrate specificity to obtain ideal catalytic activity, such as irrational and rational designs for enzyme molecular structures. Zhou [13], Mao [14], Tan [15] et al. also obtained the beneficial EPSPS mutants P106L, five-site mutants (E37V, D67N, T277S, D351G and R422G), and nine single-site mutants (R21C, N265S, A329T, P71L, T258A, L184, G292C, L35F and A242V) through irrational design; Tian [16], Kaundun [17], and Wakelin [18] et al., obtained eight-site mutants (N63D, N86S, T101A, A187T, D230G, H317R, Y339R and C413A) by rational design. Ming [19] et al., obtained highly resistant mutants from Escherichia coli and Salmonella using error prone PCR random mutation technology.
Adaptive laboratory evolution (ALE) uses the problem-solving process of nature to generate optimized genotypes that cannot be obtained by rational design [20]. It was found that environmental changes may lead to the accumulation of beneficial mutations and provide selective growth advantages for bacteria under specific environmental conditions [21,22,23]. In the long-term culture process, beneficial mutants with competitive advantage replaced the original population under the strong selection pressure exerted by external adverse factors and survived in a harsh environment [22,23] Moreover, under different environmental pressures, microorganisms will mutate in a certain direction to adapt to the environment. For example, Lenski [24], Oliver [25], Shewaramani [26], Kaitlin [27], Jeffrey [22], Huang [28] and others found the accumulation of beneficial mutants through ALE experiments. A clear knowledge of the structure–function relationship for glyphosate resistance of EPSPS is not fully known, even though some EPSPS crystal structures were analyzed [7], and some conserved motifs associated with glyphosate tolerance were identified [16]. Thus, ALE-based strategies may not only obtain high glyphosate tolerance mutants, but can also help to identify additional sites and/or motifs related to increasing glyphosate tolerance [29].
The GR79-EPSPS gene was isolated from glyphosate-contaminated soil microorganisms by metagenomics. The gene confers a glyphosate resistance of 200 mM to ER2799 (the aroA-defective strain). The study found that GR79-EPSPS had a low Km value, and Ki/Km was higher than that of some type II EPSPS [30].
In this study, a highly resistant GR79(Y40I)-EPSPS mutant was obtained through an adaptive laboratory evolution strategy. Glyphosate resistance, enzymatic kinetic parameters, molecular docking and molecular dynamics analyses were carried out to explore the principle of glyphosate resistance, so clarifying this would help facilitate the development of highly glyphosate-tolerant crops.

2. Materials and Methods

2.1. Bacterial Strains, Plasmids, and Materials

E. coli ER2799 (aroA deleted in its genome) was donated by New England Biolabs Inc., Ipswich, MA, USA. The low-copy plasmid pACYC184 was purchased from Beijing Zoman Biotechnology Co., Ltd., Beijing, China. Vector pET28a (Novagen, Inc., Darmstadt, Germany) was purchased from Vazyme Biotech Co., Ltd., Nanjing, China. Reagents for enzyme activity determination were purchased from Sigma–Aldrich. All chemicals used in this study were of reagent grade.

2.2. Plasmid Construction

The mutants of the EPSPS gene were generated by amplification with the GR79-EPSPS gene as a template and designing primers (Table 1). Clonexpress ultra one-step cloning Kit (vazyme) was used to clone the amplified fragment into pACYC184 vector and pET28a expression vector (novagen) containing C-terminal His-tag [31].

2.3. ALE Experiments

The low-copy recombinant plasmid pAGR79 (pACYC184-GR79) was constructed and transformed into ER2799 competent cells by heat shock. ALE was performed in the laboratory by sequential serial passages in shake flasks. The single clone was inoculated in 20 mL of M9 liquid medium and grown for 15–20 h at 37 °C. All of the cultures were centrifuged, and the pellets were resuspended to OD600 = 0.5 with M9 medium. Then, 1 mL of culture was subcultured in 100 mL of M9 liquid medium containing 200 mM glyphosate at 37 °C and 220 rpm in the dark. The culture was renewed every 24 h to ensure adequate nutrition. After approximately 1000 generations, strains were plated on M9 medium containing 250 mM glyphosate, To identify beneficial mutations for the observed increased glyphosate tolerance in the isolated mutants, more than 40 single colonies were selected and plasmids were sequenced.

2.4. Evaluation of Glyphosate Tolerance

The plasmids pACYC184, pAGR79, and pAGR79 (Y40I) were transformed into E. coli ER2799 competent cells and plated on LB solid medium with chloramphenicol (34 µg/mL). The positive clones were identified using PCR amplification of the EPSPS genes (Table 1). The single clone was inoculated in 20 mL of LB liquid medium and grown overnight at 37 °C. The cultures were centrifuged, and the pellets were resuspended in M9 liquid medium containing 0, 200, 300 or 400 mM glyphosate (OD600 = 0.15). Samples were incubated in a fully automated Bioscreen Plate Reader (Labsystems, Helsinki, Finland) at 37 °C, with OD600 values measured at 4 h intervals for 24 h. The resulting values were used to generate growth curves.

2.5. EPSP Synthase Assay

The protein expression plasmids were transformed into E. coli BL21 and cultured in LB medium at 37 °C until OD600 = 0.6. Isopropyl β -D-thiogalactoside (IPTG) was added, and the cells were incubated for another 16 h at 16 °C. Then, the cultures were centrifuged, and the pellets were resuspended in buffer (5 mM Tris-HCl pH 7.8, 1 mM EDTA pH 8.0, 1 mM DTT). The supernatant was isolated by centrifugation after ultrasonic crushing for 10 min. Protein samples were analyzed by SDS–PAGE.
The enzymatic kinetic parameters of EPSPS are the determination of inorganic phosphate produced in the enzyme reaction according to the malachite green dye method [32]. According to the measurement of the Km value, the concentration of substrate S3P was fixed at 1.0 mM, and the concentration of PEP in the other substrate was 0.05, 0.075, 0.1, 0.2, 0.5 or 0.6 mM. The obtained data were fitted to V = Vmax[S]/(Km + [S]), where V is the reaction rate (unit: U/mg) and Vmax is the maximum rate.
The determination of the Ki value [33] was performed by fixing the concentration of the substrate S3P at 1 mM, and the concentration of glyphosate was 0, 10−3, 10−2, 10−1, 1, 10, 100 and 500 mM. The IC50 value (glyphosate concentration inhibiting 50% enzyme activity) was obtained by fitting the data to the equation V = Vmin + (Vmax−Vmin)/(1 + ([I]/IC50)s), where s is the slope of the curve at IC50, [I] is the concentration of glyphosate and V is obtained under different glyphosate concentration gradients and 1 mM PEP and S3P.

2.6. Bioinformatics Analysis

Glyphosate substrate was imported into Schrodinger software (Maestro 11.9) to establish a database of ligand molecules for molecular docking. GR79 and GR79(Y40I)-EPSPS protein structures were obtained by Swiss-model (https://swissmodel.expasy.org/. accessed on 12 March 2021) online homology modeling. All protein structures were in Maestro 11.9 Platform for treatment. Finally, the energy of the protein was minimized, and the geometric structure was optimized [34]. When screening in the glide module, the appropriate position in receptor grid generation was specified, the active site of the protein was selected as the centroid of the 10 Å box and, finally, molecular docking and screening through the standard precision (SP) method was conducted.
Desmond 2020 was used to conduct 100 ns molecular dynamics simulations of protein and substrate compound complexes. The root mean square deviation (RMSD) of the main chain atom and the root mean square fluctuation (RMSF) of each residue. The interaction mode between the compound and the target protein was analyzed and then the docking score of the compound was obtained.

3. Results

3.1. Isolated Evolved Mutants Exhibit a Significant Increase in Glyphosate Tolerance

In ALE experiment, a total of four single-nucleotide substitutions were identified and only one amino acid substitution (Y40I) was observed. To evaluate the glyphosate tolerance of the GR79(Y40I)-EPSPS mutant, the plasmid was retransferred into ER2799, which is a defective mutant that cannot grow in M9 minimal medium. The strains containing GR79-EPSPS and GR79(Y40I)-EPSPS grew well, except ER2799 and pACYC184(ER2799 strain containing pACYC184 plasmid) (Figure 1A). When the glyphosate concentration was increased to 200 mM, the growth rate of the recombinant strains slowed down, and only the strain containing the GR79(Y40I)-EPSPS mutant grew when glyphosate reached 300 mM (Figure 1B,C). However, none of the strains grew under 400 mM glyphosate (Figure 1D). The results indicated that the GR79(Y40I)-EPSPS mutant exhibited significantly increased glyphosate tolerance compared with that of the wild-type enzyme.

3.2. Kinetic Parameters of the GR79(Y40I)-EPSPS Mutant

The GR79-EPSPS and GR79(Y40I)-EPSPS genes were cloned into the pET-28a vector and expressed proteins for enzyme assays. The kinetic constants of wild-type GR79-EPSPS and GR79(Y40I)-EPSPS mutants are shown in Table 2. Under the condition of 1 mM substrate, the specific enzyme activities of the GR79(Y40I)-EPSPS mutant and GR79-EPSPS were 17.436 (U)/mg and 14.331 (U)/mg, respectively. The IC50 value of GR79(Y40I)-EPSPS was approximately twice as high as that of GR79-EPSPS (13.995 mM and 6.8685 mM). The Km value of GR79(Y40I)-EPSPS was nearly 1.8-fold lower than that of GR79-EPSPS (22.012 μM and 39.341 μΜ), indicating that the mutant had higher PEP affinities than the wild-type protein. The Ki value of GR79(Y40I)-EPSPS was 1.7-fold that of the wild-type protein (127.343 μM and 75.360 μM), indicating that the mutant can tolerate high glyphosate concentrations (Figure 1, Table 2). Ki/Kmis is the crucial value for estimating enzymatic activity in the presence of glyphosate inhibitor because glyphosate competes with PEP for binding in the active site of EPSPS. The Ki/Km value of the GR79(Y40I)-EPSPS mutant was approximately three-fold that of wild-type EPSPS (Table 2), indicating that the 40th amino acid is one of the critical sites of the substrate-binding enzyme. Since this site has never been reported before, its glyphosate resistance mechanism needs to be further explored.

3.3. Bioinformatic Analysis of GR79(Y40I)-EPSPS

Clustal alignment of the EPSPS with GR79-EPSPS and some typical Class I, Class II EPSPS (CP4-EPSPS, cb-EPSPS) indicate that the 40th amino acid Y (tyrosine) of GR79-EPSPS is different from that of other Class I EPSPSs, which are leucine (L), isoleucine (I) or valine (V) (data not shown). Compared with these amino acids, L, I and V are all aliphatic amino acids, while Y is an aromatic amino acid containing a carbon ring. In addition, the amino acid at position 40 of GR79-EPSPS is close to the conserved motif region 1 (GDKX) of Class II EPSPS.
To investigate the interaction between the glyphosate molecule and the GR79, GR79 (Y40I)-EPSPS proteins, we used molecular dynamics to simulate the molecular dynamics of the protein and GLP molecule complex for 100 ns. The results showed that the RMSD of GR79 and GR79(Y40I)-EPSPS proteins was less than 3.5 Å and reached dynamic equilibrium in a short time (20 ns), indicating that the protein itself had good stability (Figure 2A). After mutation, the RMSD of the GR79(Y40I)-EPSPS·GLP complex increased significantly, and the binding energy also increased from −6.71 to −6.41 kcal/mol, indicating that the stability of the complex worsened(Figure 2B).
These results indicate that GLP molecule binding to the enzyme was blocked by the Y40I substitution to improve glyphosate resistance.
The structure of GR79-EPSPS was modeled in Swiss-model, referring to the Colwellia psychrythraea EPSPS (pdb-5xwb. 2. A). The structural model of EPSPS shows the position of the Y40I substitution (Figure 3A,B). The protein folded into two globular hemispheric domains connected by a two-stranded hinge. The residue mutated in position 40 was located on the inside of the active site cleft that may form when the two domains are close together. In the GR79(Y40I)-EPSPS mutant, the hydroxyphenyl group of tyrosine was replaced with the methyl group of isoleucine, so both donor and acceptor hydrogen bond counts decreased. Molecular docking results showed that the GLP molecule connected amino acid residues in the active sites (Figure 3C,D), such as Lys-38, Thr-110, Arg-113, and Arg-138, with five hydrogen bonds in the wild-type protein but four hydrogen bonds in the GR79(Y40I)-EPSPS mutant, indicating that the Y40I substitution could weaken competition in the active site with respect to glyphosate. Moreover, the spatial structure of the protein was gently changed in the Y40I substitution; for example, the hydrogen bond distance between the side chain of glyphosate and Lys-38 increased from 2.0 to 2.8 Å. We speculate that the decrease in the binding ability of glyphosate to the Y40I mutant was the main reason for the improvement of glyphosate resistance.

4. Discussion

In recent years, various methods have been used to obtain EPSPS mutants with increased glyphosate resistance. ALE can provide a large number of adaptive mutations and accumulate adaptive changes, which may be a good choice for acquiring beneficial mutations [29]. Patrick [35] et al. obtained a mesophilic subtilisin-like protease mutant adapted to low temperature using a strategy of laboratory evolution. Podracky [36] et al. used laboratory evolution to optimize the specificity of a modified amyloid-β protein and generated a sortase variant, SrtAβ, resulting in a >1400-fold change in substrate preference. In this study, the GR79(Y40I)-EPSPS mutant was obtained using the ALE strategy. The results showed that the mutant enzyme can endow the E. coli strain to grow in minimal medium containing 300 mM glyphosate, and the glyphosate resistance was nearly 1.5-fold higher than that of the wild-type enzyme. Therefore, we discussed the relationship between glyphosate resistance and the mutation site of mutant GR79(Y40I)-EPSPS.
Studies have shown that when EPSPS binds to ligands, the two domains are closed, resulting in the formation of an active site in the cracks between domains [37]. Modification of amino acid residues in or around the active region will significantly change the activity and glyphosate resistance of EPSPS. For example, the alterations of Gly-96-Ala in E. coli and Pro-101-Ser in S. typhimurium have been shown to confer glyphosate resistance [38,39]. The Pro-106 mutant in Zea mays is not directly involved in catalysis or glyphosate binding, but changes the binding of glyphosate by changing the spatial force of adjacent amino acids [10]. In our study, the 40th amino acid Y of GR79- EPSPS was immediately adjacent to the conserved motif region 1 (GDKX) of Class II EPSPS. Studies have shown that although EPSPSs are divided into several categories, the active sites are highly conserved and rarely change in some organisms [40]. Class I and II EPSPSs active sites have some similarities [41]. Therefore, the substitution of this site will indirectly affect the resistance of EPSPS glyphosate.
The multiple sequence alignment shows that the 40th amino acids are all nonpolar, and the Y of GR79-EPSPS is specific and contains a carbon ring. However, the amino acids of the remaining Class I EPSPSs are L, I, or V, and all have no ring structure. This result is very similar to the phenomenon that mutation of the Pro-106 site leads to an increase in glyphosate resistance. It has been reported that glyphosate resistance is improved after Pro-106 is mutated to S, A, T and L in barnyard grass, Eleusine India and Lolium rigidum Gaud [5,17,18]. Because the Pro (P) has a ring structure, the ring prevents the Φ peptide bond (Cα-N). After being mutated, the spatial direction of Arg-105 and Asp-99 may change, and Alycyl-101 can form hydrogen bonds with glyphosate [42]. This series of structural changes reduced the binding cavity of glyphosate on EPSPS and increased glyphosate resistance [42]. Our docking and molecular dynamics analyses indicate that Tyr-40 of GR79 is immediately adjacent to Lys-38. Lys-38 has a variety of interactions with glyphosate. When Y40I substitution occurs, the local space of the 38th amino acid is released, which makes Lys-38 undergo more spatial changes. The hydrogen bond distance between glyphosate and Lys-38 increased from 2.0 to 2.8 Å, and the binding energy increased from −6.71 kcal/mol to −6.41 kcal/mol, indicating that the binding capacity between EPSPS and glyphosate was weakened, which may be the key reason for improving the glyphosate resistance of EPSPS.
The Y40I substitution in this study provides a potential strategy; that is, the change in a single amino acid at the inactive site in Class I EPSP can increase the resistance to glyphosate. Moreover, the results of this study provide a theoretical basis for developing and optimizing the application of EPSP synthase.

5. Conclusions

In this study, we identified a GR79(Y40I)-EPSPS mutant using adaptive laboratory evolution. Kinetic analysis showed that this single amino-acid substitution increased Ki[glyphosate] and decreased Km [PEP], indicating that the Y40I substitution enhanced EPSPS resistance. It is proposed that this altered EPSP synthase may provide great herbicide resistance when it is expressed in plant cells.

Author Contributions

Conceptualization, Y.Y. (Yuan Yuan), M.L., W.L. and J.W.; methodology, Y.Y. (Yongliang Yan) and Y.Z.; validation, Y.Y. (Yuan Yuan)and X.K.; formal analysis, Y.Y. (Yongliang Yan) and Z.Z.; investigation, P.L. and S.J.; resources, W.L. and J.W.; data curation, Y.Y. (Yuan Yuan) and W.L.; writing—original draft preparation, Y.Y. (Yuan Yuan); writing—review and editing, W.L. and Z.Z.; visualization, Y.Y. (Yuan Yuan); supervision, W.L. and J.W.; project administration, W.L. and J.W.; funding acquisition, W.L. and J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by National Key R&D Program of China (Nos. 2018YFA0901000, 2018YFA0901003), Natural Science Foundation of China (31930004 and 32150021), the Strategic Priority Research Program of the Chinese Academy of Sciences (Grant No. XDA28030201).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kishore, G.M.; Shah, D.M. Amino Acid Biosynthesis Inhibitors as Herbicides. Annu. Rev. Biochem. 1988, 57, 627–663. [Google Scholar] [CrossRef] [PubMed]
  2. Shikimic Acid; Metabolism and Metabolites. Int. J. Biochem. 1994, 26, 855. [CrossRef]
  3. Firdous, S.; Iqbal, S.; Anwar, S.; Jabeen, H. Identification and Analysis of 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS) Gene from Glyphosate-Resistant Ochrobactrum Intermedium Sq20: Identification of EPSPS from Ochrobactrum Intermedium SqPest. Manag. Sci. 2018, 74, 1184–1196. [Google Scholar] [CrossRef]
  4. Brunharo, C.A.; Patterson, E.L.; Carrijo, D.R.; de Melo, M.S.; Nicolai, M.; Gaines, T.A.; Nissen, S.J.; Christoffoleti, P.J. Confirmation and Mechanism of Glyphosate Resistance in Tall Windmill Grass (Chloris Elata) from Brazil: Glyphosate Resistance in Tall Windmill Grass (Chloris Elata) from Brazil. Pest. Manag. Sci. 2016, 72, 1758–1764. [Google Scholar] [CrossRef]
  5. Alarcón-Reverte, R.; García, A.; Watson, S.B.; Abdallah, I.; Sabaté, S.; Hernández, M.J.; Dayan, F.E.; Fischer, A.J. Concerted Action of Target-Site Mutations and High EPSPS Activity in Glyphosate-Resistant Junglerice (Echinochloa Colona) from California: Glyphosate-Resistant Echinochloa Colona in California. Pest. Manag. Sci. 2015, 71, 996–1007. [Google Scholar] [CrossRef]
  6. Leino, L.; Tall, T.; Helander, M.; Saloniemi, I.; Saikkonen, K.; Ruuskanen, S.; Puigbò, P. Classification of the Glyphosate Target Enzyme (5-Enolpyruvylshikimate-3-Phosphate Synthase). Bioinformatics 2020, 408, 124556. [Google Scholar]
  7. Light, S.H.; Krishna, S.N.; Minasov, G.; Anderson, W.F. An Unusual Cation-Binding Site and Distinct Domain–Domain Interactions Distinguish Class II Enolpyruvylshikimate-3-Phosphate Synthases. Biochemistry 2016, 55, 1239–1245. [Google Scholar] [CrossRef]
  8. Pollegioni, L.; Schonbrunn, E.; Siehl, D. Molecular Basis of Glyphosate Resistance—Different Approaches through Protein Engineering: Mechanisms of Glyphosate Resistance. FEBS J. 2011, 278, 2753–2766. [Google Scholar] [CrossRef] [Green Version]
  9. Priestman, M.A.; Funke, T.; Singh, I.M.; Crupper, S.S.; Schönbrunn, E. 5-Enolpyruvylshikimate-3-Phosphate Synthase from Staphylococcus Aureus Is Insensitive to Glyphosate. FEBS Lett. 2005, 579, 728–732. [Google Scholar] [CrossRef] [Green Version]
  10. Funke, T.; Yang, Y.; Han, H.; Healy-Fried, M.; Olesen, S.; Becker, A.; Schönbrunn, E. Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr 97 → Ile and Pro 101 → Ser in 5-Enolpyruvylshikimate-3-Phosphate Synthase from Escherichia Coli. J. Biol. Chem. 2009, 284, 9854–9860. [Google Scholar] [CrossRef] [Green Version]
  11. Perotti, V.E.; Larran, A.S.; Palmieri, V.E.; Martinatto, A.K.; Alvarez, C.E.; Tuesca, D.; Permingeat, H.R. A Novel Triple Amino Acid Substitution in the EPSPS Found in a High-level Glyphosate-resistantAmaranthus hybridusPopulation from Argentina. Pest. Manag. Sci. 2019, 75, 1242–1251. [Google Scholar] [CrossRef] [PubMed]
  12. Franci, J.; Lam, K.W.; Chuah, T.S.; Cha, T.S. Genetic Diversity and in Silico Evidence of Target-Site Mutation in the EPSPS Gene in Endowing Glyphosate Resistance in Eleusine Indica (L.) from Malaysia. Pestic. Biochem. Physiol. 2020, 165, 104556. [Google Scholar] [CrossRef] [PubMed]
  13. Identification of a Glyphosate-Resistant Mutant of Rice 5-Enolpyruvylshikimate 3-Phosphate Synthase Using a Directed Evolution Strategy. Plant Physiol. 2006, 140, 184–195. [CrossRef] [PubMed] [Green Version]
  14. Mao, C.; Xie, H.; Chen, S.; Valverde, B.E.; Qiang, S. Error-Prone PCR Mutation of Ls-EPSPS Gene from Liriope Spicata Conferring to Its Enhanced Glyphosate-Resistance. Pestic. Biochem. Physiol. 2017, 141, 90–95. [Google Scholar] [CrossRef]
  15. Tan, X.L.; Othman, R.Y.; Teo, C.H. Isolation and Functional Characterization of 5-Enolpyruvylshikimate 3-Phosphate Synthase Gene from Glyphosate-Tolerant Pseudomonas Nitroreducens Strains FY43 and FY47. 3 Biotech 2020, 10, 183. [Google Scholar] [CrossRef]
  16. Tian, Y.-S.; Xu, J.; Peng, R.-H.; Xiong, A.-S.; Xu, H.; Zhao, W.; Fu, X.-Y.; Han, H.-J.; Yao, Q.-H. Mutation by DNA Shuffling of 5-Enolpyruvylshikimate-3-Phosphate Synthase from Malus Domestica for Improved Glyphosate Resistance. Plant Biotechnol. J. 2013, 11, 829–838. [Google Scholar] [CrossRef]
  17. Kaundun, S.S.; Zelaya, I.A.; Dale, R.P.; Lycett, A.J.; Carter, P.; Sharples, K.R.; McIndoe, E. Importance of the P106S Target-Site Mutation in Conferring Resistance to Glyphosate in a Goosegrass (Eleusine Indica) Population from the Philippines. Weed Sci. 2008, 56, 637–646. [Google Scholar] [CrossRef]
  18. Wakelin, A.M.; Preston, C. Inheritance of Glyphosate Resistance in Several Populations of Rigid Ryegrass (Lolium Rigidum) from Australia. Weed Sci. 2006, 54, 212–219. [Google Scholar] [CrossRef]
  19. He, M.; Yang, Z.-Y.; Nie, Y.-F.; Wang, J.; Xu, P. A New Type of Class I Bacterial 5-Enopyruvylshikimate-3-Phosphate Synthase Mutants with Enhanced Tolerance to Glyphosate. Biochim. Et Biophys. Acta (BBA)—Gen. Subj. 2001, 1568, 1–6. [Google Scholar] [CrossRef]
  20. Phaneuf, P.V.; Zielinski, D.C.; Yurkovich, J.T.; Johnsen, J.; Szubin, R.; Yang, L.; Kim, S.H.; Schulz, S.; Wu, M.; Dalldorf, C. and Escherichia Coli Data-Driven Strain Design Using Aggregated Adaptive Laboratory Evolution Mutational Data. ACS Synth. Biol. 2021, 10, 3379–3395. [Google Scholar] [CrossRef]
  21. Cairns, J.; Overbaugh, J.; Miller, S. The Origin of Mutants. Nature 1988, 335, 142–145. [Google Scholar] [CrossRef] [PubMed]
  22. Barrick, J.E.; Yu, D.S.; Yoon, S.H.; Jeong, H.; Oh, T.K.; Schneider, D.; Lenski, R.E.; Kim, J.F. Genome Evolution and Adaptation in a Long-Term Experiment with Escherichia Coli. Nature 2009, 461, 1243–1247. [Google Scholar] [CrossRef]
  23. Blount, Z.D.; Barrick, J.E.; Davidson, C.J.; Lenski, R.E. Genomic Analysis of a Key Innovation in an Experimental Escherichia Coli Population. Nature 2012, 489, 513–518. [Google Scholar] [CrossRef] [PubMed]
  24. Lenski, R.E. Phenotypic and Genomic Evolution during a 20,000—Generation Experiment with the Bacterium Escherichia Coli. Plant Breed. Rev. 2004, 24, 225–266. [Google Scholar]
  25. Oliver, A.; Cantón, R.; Campo, P.; Baquero, F.; Blázquez, J. High Frequency of Hypermutable Pseudomonas Aeruginosa in Cystic Fibrosis Lung Infection. Science 2000, 288, 1251–1253. [Google Scholar] [CrossRef]
  26. Shewaramani, S.; Finn, T.J.; Leahy, S.C.; Kassen, R.; Rainey, P.B.; Moon, C.D. Anaerobically Grown Escherichia Coli Has an Enhanced Mutation Rate and Distinct Mutational Spectra. PLoS Genet. 2017, 13, e1006570. [Google Scholar] [CrossRef]
  27. Creamer, K.E.; Ditmars, F.S.; Basting, P.J.; Kunka, K.S.; Hamdallah, I.N.; Bush, S.P.; Scott, Z.; He, A.; Penix, S.R.; Gonzales, A.S.; et al. Benzoate- and Salicylate-Tolerant Strains of Escherichia Coli K-12 Lose Antibiotic Resistance during Laboratory Evolution. Appl Env. Microbiol 2017, 83, e02736-16. [Google Scholar] [CrossRef] [Green Version]
  28. Huang, X.-J.; Du, H.; Deng, X.-L.; Chen, Y.-H.; Xiang, L.; Li, Y.-W.; Li, H.; Mo, C.-H.; Cai, Q.-Y.; Zhao, H.-M. New Insights into the Evolution of Bacterial Community during the Domestication of Phthalate-Degrading Consortium. J. Clean. Prod. 2021, 303, 127064. [Google Scholar] [CrossRef]
  29. Portnoy, V.A.; Bezdan, D.; Zengler, K. Adaptive Laboratory Evolution—Harnessing the Power of Biology for Metabolic Engineering. Curr. Opin. Biotechnol. 2011, 22, 590–594. [Google Scholar] [CrossRef]
  30. Cao, G.; Liu, Y.; Zhang, S.; Yang, X.; Chen, R.; Zhang, Y.; Lu, W.; Liu, Y.; Wang, J.; Lin, M.; et al. A Novel 5-Enolpyruvylshikimate-3-Phosphate Synthase Shows High Glyphosate Tolerance in Escherichia Coli and Tobacco Plants. PLoS ONE 2012, 7, e38718. [Google Scholar] [CrossRef] [Green Version]
  31. Meng, Y.; Tang, Y.; Zhang, X.; Wang, J.; Zhou, Z. Molecular Identification of Keratinase DgokerA from Deinococcus Gobiensis for Feather Degradation. Appl. Sci. 2022, 12, 464. [Google Scholar] [CrossRef]
  32. Lanzetta, P.A.; Alvarez, L.J.; Reinach, P.S.; Candia, O.A. An Improved Assay for Nanomole Amounts of Inorganic Phosphate. Anal. Biochem. 1979, 100, 95–97. [Google Scholar] [CrossRef]
  33. Walters, D.E. Enzymes: A Practical Introduction to Structure, Mechanism, and Data Analysis, 2nd Ed; Copeland, R.A., Ed.; John Wiley & Sons: New York, NY, USA.2000, Xvi + 397 Pp. 16 × 24.5 Cm. ISBN 0-471-35929-7. $99. J. Med. Chem. 2002, 45, 5607. [Google Scholar] [CrossRef]
  34. Fazi, R.; Tintori, C.; Brai, A.; Botta, L.; Selvaraj, M.; Garbelli, A.; Maga, G.; Botta, M. Homology Model-Based Virtual Screening for the Identification of Human Helicase DDX3 Inhibitors. J. Chem. Inf. Model. 2015, 55, 2443–2454. [Google Scholar] [CrossRef] [PubMed]
  35. Wintrode, P.L.; Miyazaki, K.; Arnold, F.H. Cold Adaptation of a Mesophilic Subtilisin-like Protease by Laboratory Evolution. J. Biol. Chem. 2000, 275, 31635–31640. [Google Scholar] [CrossRef] [Green Version]
  36. Podracky, C.J.; An, C.; DeSousa, A.; Dorr, B.M.; Walsh, D.M.; Liu, D.R. Laboratory Evolution of a Sortase Enzyme That Modifies Amyloid-β Protein. Nat. Chem. Biol. 2021, 17, 317–325. [Google Scholar] [CrossRef]
  37. Boocock, M.R.; Coggins, J.R. Kinetics of 5-Enolpyruvylshikimate-3-Phosphate Synthase Inhibition by Glyphosate. Febs Lett. 1983, 154, 127–133. [Google Scholar] [CrossRef] [Green Version]
  38. Padgette, S.R.; Huynh, Q.K.; Aykent, S.; Sammons, R.D.; Sikorski, J.A.; Kishore, G.M. Identification of the Reactive Cysteines of Escherichia Coli 5-Enolpyruvylshikimate-3-Phosphate Synthase and Their Nonessentiality for Enzymatic Catalysis. J. Biol. Chem. 1988, 263, 1798–1802. [Google Scholar] [CrossRef]
  39. Stalker, D.M.; Hiatt, W.R.; Comai, L. A Single Amino Acid Substitution in the Enzyme 5-Enolpyruvylshikimate-3-Phosphate Synthase Confers Resistance to the Herbicide Glyphosate. J. Biol. Chem. 1985, 260, 4724–4728. [Google Scholar] [CrossRef]
  40. Rainio, M.J.; Ruuskanen, S.; Helander, M.; Saikkonen, K.; Saloniemi, I.; Puigbò, P. Adaptation of Bacteria to Glyphosate: A Microevolutionary Perspective of the Enzyme 5-Enolpyruvylshikimate-3-Phosphate (EPSP) Synthase. Microbiology 2020, 13(3), 309–316. [Google Scholar]
  41. Funke, T.; Han, H.; Healy-Fried, M.L.; Fischer, M.; Schonbrunn, E. Molecular Basis for the Herbicide Resistance of Roundup Ready Crops. Proc. Natl. Acad. Sci. USA 2006, 103, 13010–13015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Kaundun, S.S.; Dale, R.P.; Zelaya, I.A.; Dinelli, G.; Marotti, I.; McIndoe, E.; Cairns, A. A Novel P106L Mutation in EPSPS and an Unknown Mechanism(s) Act Additively To Confer Resistance to Glyphosate in a South African Lolium Rigidum Population. J. Agric. Food Chem. 2011, 59, 3227–3233. [Google Scholar] [CrossRef] [PubMed]
Applsci 12 05723 g001 550
Figure 1. The growth curves of E. coli harboring pACYC184, pAGR79 and pAGR79(Y40I) plasmids under different concentrations of glyphosate. (A) 0 mM glyphosate; (B) 200 mM glyphosate; (C) 300 mM glyphosate; and (D) 400 mM glyphosate. Data are expressed as the average ± S.E. of three independent experiments.
Figure 1. The growth curves of E. coli harboring pACYC184, pAGR79 and pAGR79(Y40I) plasmids under different concentrations of glyphosate. (A) 0 mM glyphosate; (B) 200 mM glyphosate; (C) 300 mM glyphosate; and (D) 400 mM glyphosate. Data are expressed as the average ± S.E. of three independent experiments.
Applsci 12 05723 g001
Applsci 12 05723 g002 550
Figure 2. Molecular dynamics analysis diagram. (A) Molecular dynamics analysis of GR79-EPSPS and GR79(Y40I)-EPSPS without substrate (glyphosate); (B) molecular dynamics analysis of GR79-EPSPS and GR79(Y40I)-EPSPS combined with glyphosate. GR79-EPSPS is marked in dark blue, and GR79(Y40I)-EPSPS is marked in light blue.
Figure 2. Molecular dynamics analysis diagram. (A) Molecular dynamics analysis of GR79-EPSPS and GR79(Y40I)-EPSPS without substrate (glyphosate); (B) molecular dynamics analysis of GR79-EPSPS and GR79(Y40I)-EPSPS combined with glyphosate. GR79-EPSPS is marked in dark blue, and GR79(Y40I)-EPSPS is marked in light blue.
Applsci 12 05723 g002
Applsci 12 05723 g003 550
Figure 3. Ribbon diagram of the crystal structure of EPSPS and the active site in glyphosate-liganded EPSPS. (A) Crystal structure of the open conformation of GR79-EPSPS. Tyr-40 is shown in purple. (B) Crystal structure of the open conformation of GR79(Y40I)-EPSPS. Ile-40 is shown in purple. (C) The structure of the GR79-EPSPS·GLP complex. (D) The structure of the GR79(Y40I)-EPSPS·GLP complex. The yellow dotted line represents the hydrogen bond.
Figure 3. Ribbon diagram of the crystal structure of EPSPS and the active site in glyphosate-liganded EPSPS. (A) Crystal structure of the open conformation of GR79-EPSPS. Tyr-40 is shown in purple. (B) Crystal structure of the open conformation of GR79(Y40I)-EPSPS. Ile-40 is shown in purple. (C) The structure of the GR79-EPSPS·GLP complex. (D) The structure of the GR79(Y40I)-EPSPS·GLP complex. The yellow dotted line represents the hydrogen bond.
Applsci 12 05723 g003
Table
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Name of PrimersSequences (5′ to 30′)
pETGR79-FATGGGTCGCGGATCCGAATTCAT-
GTCACATTCTACCTCTAGGTCCC
pETGR79-RGTGGTGGTGGTGGTGCTCGAGATA-
TACTCCACATGTATTCCAAACTTCT
pAGR79-FCCACACCCGTCCTGTGGATCC-
ATGTCACATTCTACCTCTAGGTCCC
pAGR79-RCTCTCAAGGGCATCGGTCGAC-
TTAATTATACTCCACATGTATTCCAAACTT
Table
Table 2. Kinetic parameters of GR79-EPSPS and GR79(Y40I)-EPSPS.
Table 2. Kinetic parameters of GR79-EPSPS and GR79(Y40I)-EPSPS.
Kinetic ConstantsGR79-EPSPSGR79(Y40I)-EPSPS
Specific activity (U/mg)14.331 ± 0.14417.436 ± 0.379
IC50(glyphosate; mM)6.8685 ± 1.378513.995 ± 2.815
Km (PEP; μM)39.341 ± 3.2122.012 ± 2.673
Ki (glyphosate; μM)75.360 ± 5.029127.343 ± 14.338
Vmax(U/mg)9.285 ± 0.22321.406 ± 0.824
Ki/Km (PEP)1.9165.785
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yuan, Y.; Zhou, Z.; Zhan, Y.; Ke, X.; Yan, Y.; Lin, M.; Li, P.; Jiang, S.; Wang, J.; Lu, W. A Highly Glyphosate-Resistant EPSPS Mutant from Laboratory Evolution. Appl. Sci. 2022, 12, 5723. https://doi.org/10.3390/app12115723

AMA Style

Yuan Y, Zhou Z, Zhan Y, Ke X, Yan Y, Lin M, Li P, Jiang S, Wang J, Lu W. A Highly Glyphosate-Resistant EPSPS Mutant from Laboratory Evolution. Applied Sciences. 2022; 12(11):5723. https://doi.org/10.3390/app12115723

Chicago/Turabian Style

Yuan, Yuan, Zhengfu Zhou, Yuhua Zhan, Xiubin Ke, Yongliang Yan, Min Lin, Pengcheng Li, Shijie Jiang, Jin Wang, and Wei Lu. 2022. "A Highly Glyphosate-Resistant EPSPS Mutant from Laboratory Evolution" Applied Sciences 12, no. 11: 5723. https://doi.org/10.3390/app12115723

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop