Next Article in Journal
Air Frosts in Poland in the Thermal Growing Season (AT > 5 °C)
Previous Article in Journal
Assessment of the Effects of the Herbicide Aclonifen and Its Soil Metabolites on Soil and Aquatic Environments
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 13
Issue 6
10.3390/agriculture13061227
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of Multiplex RT-PCR Assay for the Simultaneous Detection of Four Systemic Diseases Infecting Citrus

by
Shun-Min Yao
1,
Meng-Ling Wu
2 and
Ting-Hsuan Hung
1,*
1
Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 10617, Taiwan
2
Division of Forest Protection, Taiwan Forestry Research Institute, Taipei 10066, Taiwan
*
Author to whom correspondence should be addressed.
Agriculture 2023, 13(6), 1227; https://doi.org/10.3390/agriculture13061227
Submission received: 5 May 2023 / Revised: 31 May 2023 / Accepted: 8 June 2023 / Published: 10 June 2023
(This article belongs to the Section Crop Protection, Diseases, Pests and Weeds)
Browse Figures
Versions Notes

Abstract

:
The citrus systemic diseases, including citrus Huanglongbing (caused by Candidatus Liberibacter asiaticus (CLas)), citrus tristeza (caused by citrus tristeza virus (CTV)), citrus tatter leaf (caused by citrus tatter leaf virus (CTLV)), and citrus exocortis (caused by citrus exocortis viroid (CEVd)), are threats to citrus production in Taiwan. Reliable diagnostic methods are important for the management of these systemic diseases. In this study, we developed a multiplex reverse transcription–polymerase chain reaction (RT-PCR) assay to detect four pathogens simultaneously. Herein, the specific amplicons from each pathogen (295 bp for CLas, 468 bp for CTV, 120 bp for CTLV, and 196 bp for CEVd) were successfully produced using the optimized multiplex RT-PCR described here. The sensitivity evaluation showed that low titers of pathogens could be detected using this multiplex RT-PCR. Compared with the published simplex assays, the detection of field samples using the multiplex RT-PCR developed in this study showed a better performance. The detections using multiplex RT-PCR revealed that these four citrus systemic pathogens were commonly found in fields, and 30.0% of field samples were mix-infected. To our knowledge, this is the first study of a survey of the four important citrus systemic diseases in Taiwan, and it provides insights for improving disease management. Therefore, the multiplex RT-PCR assay provides a useful method for routine disease surveying and the production of pathogen-free citrus plants.

1. Introduction

Citrus is one of the most important crops worldwide. More than 140 countries across the world produce citrus fruits, and the main citrus-producing countries are China, Brazil, India, Mexico, and the United States of America [1]. The FAO statistical bulletin reported that the world’s total citrus production was at 143 million tonnes in 2019 [2]. In Taiwan, citrus production was at 465 thousand tonnes, and it was the highest yield of fruit crops in 2021 [3]. Systemic diseases caused by viruses and virus-like pathogens often lead to reductions in fruit quality and yield [4]. Among these diseases, citrus Huanglongbing (HLB), citrus tristeza, citrus tatter leaf, and citrus exocortis are considered the most important threats to this crop in Taiwan.
HLB, caused by the Gram-negative, nonculturable, and phloem-limited bacterium Candidatus Liberibacter asiaticus (CLas), is currently the most destructive disease of citrus crops worldwide [5,6]. CLas can infect all commercial citrus cultivars and shortens the lifespan of infected trees [7]. HLB-affected trees typically showed symptoms on leaves such as mottling, yellowing, hardening, and/or vein corking. HLB is spread via vegetative propagation and insect vector (Asian citrus psyllid, Diaphorina citri) in a persistent manner [7,8]. HLB was first recorded in 1951 (called Likubin) in Taiwan and has become the major limiting factor of the citrus industry since then [7]. Four CLas strains are characterized according to the pathogenicity and virulence of different citrus cultivars. Strain II, the highly virulent strain on all cultivars, is currently prevalent in Taiwan [9].
Citrus tristeza is caused by the citrus tristeza virus (CTV) [10]. CTV is an ssRNA virus with a 19.3 kb genome (containing twelve open reading frames (ORFs)) belonging to the genus Closterovirus (family Closteroviridae) and transmitted by various aphid species (brown citrus aphid, Toxoptera citricida, the most efficient vector of CTV) in a semipersistent manner, and also via graft transmission [11,12]. Symptoms of CTV are varied according to citrus cultivars and virus strains [13]. The strains of CTV are complex. CTV strains in Taiwan are primarily identified based on the symptom expression as the seedling yellow (SY) strain and the stem-pitting (SP) strain. The common CTV strain in Taiwan causes yellow seedlings in Eureka lemon, and severe strains cause stem pitting in sweet oranges and pummelos [4].
Citrus tatter leaf is caused by the citrus tatter leaf virus (CTLV) [14]. CTLV is a member of the genus Capillovirus (family Betaflexiviridae) with an ssRNA genome of 6.5 kb (encoding two ORFs) and is considered an isolate of apple stem grooving virus (ASGV) [14,15]. The CTLV is transmitted through mechanical inoculation and infected bud propagation [16]. CTLV infection results in tattered and yellowing leaves in trifoliate orange and its hybrids such as citrange and citrimelo [17].
The causal agent of citrus exocortis, the citrus exocortis viroid (CEVd) belonging to the genus Pospiviroid (family Pospiviroidae), is a circular, noncoding ssRNA with tiny genome sizes (365–475 nt) and primarily transmitted via grafting and mechanical inoculation [18]. CEVd induces bark scaling on the rootstock (trifoliate orange cultivars and their hybrids, and Rangpur lime) and then causes the stunting of the entire tree [19].
Because there are no controls for these four major systemic citrus diseases in Taiwan, vector control and prevention are critical for integrated management. Diagnosis and indexing methods play important roles in restricting the spread of diseases. Bioassay requires numerous indicator plants and is time-consuming [4]. Currently, serological and molecular techniques are widely applied for detection. Sensitive diagnostic methods using enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR), and reverse transcription–PCR (RT-PCR) have been commonly used for the detection of CLas, CTV, CTLV, and CEVd [18,20,21,22,23]. ELISA is based on the specific antigen–antibody interaction and is considered the cost-effective diagnostic method for large-scale screening [24]. PCR and RT-PCR assays, which are powerful tools for detection, offer several advantages over ELISA because of their high specificity and sensitivity. However, one target is detected per reaction in all these methods [25]. Multiplex PCR and RT-PCR allow for the simultaneous detection of several pathogens, so these methods are useful in routine surveys and citrus budwood certification programs due to saving labor, time, and cost [25]. To date, several multiplex RT-PCR assays have been developed and used in different crops [26,27,28,29,30].
In this study, a multiplex RT-PCR assay was established for simultaneously detecting CLas, CTV, CTLV, and CEVd. This diagnostic method will be useful in the epidemiology of these pathogens and the management of citrus systemic diseases.

2. Materials and Methods

2.1. Plant Materials and Pathogen Sources

The citrus pathogens used in this study were CLas, CTV, CTLV, and CEVd. The disease scions were collected from orchards in Chiayi and grafted to healthy citrus plants to serve as positive controls. The citrus cultivars Liucheng sweet orange (Citrus sinensis), Troyer citrange (C. sinensis × Poncirus trifoliata), and Rangpur lime (C. limonia) were used for CLas and CTV, as well as CTLV and CEVd inoculation, respectively. Healthy citrus plants were obtained from pathogen-free seedlings, and each plant was grafted onto the three infected scions. All the experimental plants were kept in insect-free greenhouses under room temperature conditions. For field surveys, six citrus cultivars, namely Eureka lemon (C. limon), Tankan tangor (C. tankan), Ponkan mandarin (C. reticulata), Liucheng sweet orange (C. sinensis), Murcott tangor (C. reticulate × C. sinensis), and Wentan pomelo (C. grandis), and unknown cultivars were randomly collected from different orchards (in Yunlin, Chiayi, Tainan, Pingtung, and Hualian) in Taiwan during 2021–2023. The field samples were also subjected to the currently used PCR and RT-PCR assays in Taiwan for comparison. These simplex assays used for the detection of CLas, CTV, CTLV, and CEVd are described in [18,21,22,23]. In total, 100 citrus seedling orchards were collected for detection from three seedling orchards. Seedling orchards 1 and 2 were located in Chiayi, and seedling orchard 3 was in Pingtung. In total, 80 seedlings were collected from seedling orchards 1 and 2 (20 Ponkan mandarin seedlings and 20 Wentan pomelo seedlings from each orchard), and 20 Eureka lemon seedlings from seedling orchard 3. Leaf samples were collected for the total nucleic acid isolation and evaluation of multiplex RT-PCR assay.

2.2. Total Nucleic Acid Isolation

The protocol of total nucleic acid isolation was carried out following Hung et al. [21], with some modifications. Briefly, 0.5 g leaf midrib was ground into a powder with liquid nitrogen. The powder was mixed with 2.7 mL extraction buffer (100 mM Tris-HCl (pH 8.0), 100 mM EDTA, 250 mM NaCl) and 0.3 mL 10% N-lauroylsarcosine. Then, the sap was transferred to a 2.0 mL Eppendorf tube and incubated at 55 °C for 10 min. After centrifugation (6000× g for 5 min), 800 µL of supernatant was collected and treated with 600 µL of phenol–chloroform–isoamyl alcohol (25:24:1). The mixture was centrifuged at 12,000× g for 5 min, and the 400 µL supernatant was collected. After adding 240 µL of isopropanol, the mixture was transferred to a Gene-Spin spin column with a collection tube (Protech, Taipei, Taiwan) and spun at 12,000× g for 1 min. Briefly, 700 µL of 70% ethanol was added to the spin column and centrifuged at 12,000× g for 3 min. The spin column was placed in a new 1.5 mL Eppendorf tube, and then 100 µL of TE buffer (65 °C) was added for eluting the total nucleic acid via centrifugation (12,000× g for 1 min).

2.3. Primer Design

The primer pair for CLas were designed based on the CLas-specific trmU-tufB-secE-nusG-rplKAJL-rpoB gene cluster region (Figure 1). The trmU-tufB-secE-nusG-rplKAJL-rpoB sequences of CLas Taiwan isolates (GenBank Accession No. AB480136.1, AB480137.1, AB480138.1, AB480139.1, and AB480140.1) were used for the design of primers. The properties of primers were analyzed using OligoEvaluatorTM (http://www.oligoevaluator.com/LoginServlet (accessed on 5 March 2021)). Primer sets used for CTV, CTLV, and CEVd detection were described previously [18,23,31]. Specific primer pairs for CTV, CTLV, and CEVd were targeted at the partial p27/p25 protein gene, the coat protein gene, and the conserved region, respectively. These primer sets were chosen primarily based on similar annealing temperatures (56 °C to 60 °C) and PCR product sizes. The details of all primers are listed in Table 1.

2.4. RT-PCR Assay

For the first strand cDNA synthesis, 8 µL of total nucleic acid and 1 µL of random primer were incubated at 65 °C for 5 min and quickly chilled on ice. Then, 4 µL of 5× RT buffer, 2 µL of dNTPs, 2 µL of DTT, and 1 µL of SuperScript II Reverse Transcriptase (Invitrogen, Waltham, MA, USA) were added. The reverse transcription was incubated at 25 °C for 15 min and finished at 50 °C for 35 min. The RT reactions were performed using a DNA thermal cycler 2720 (Applied Biosystems, Waltham, MA, USA).
The PCR reaction was performed using a 25 µL mixture containing 12.5 µL of ExpressGO PCR PreMix (BiOptic, New Taipei City, Taiwan), 2.5 µL of cDNA, 0.4 µM of CLas-295F/R, 0.4 µM of CTV-468F/R, 0.4 µM of CTLV-120F/R, and 0.2 µM of CEVd-196F/R. The PCR thermal cycling conditions were as follows: 1 cycle at 95 °C for 5 min; 40 cycles at 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 10 min. Reactions were carried out in a DNA thermal cycler 2720 (ABI). PCR products were analyzed using 2% agarose gel electrophoresis.

2.5. Cloning of Amplicons

The amplified products were purified by using the QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany). Cloning was performed via ligation into the pCR2.1-TOPO vector and transformed into Escherichia coli DH5α competent cells, according to the manufacturer’s instructions (Invitrogen, Waltham, MA, USA). The plasmids containing amplicons were used for sequencing and subjected to the optimization and sensitivity test of multiplex RT-PCR assay.

3. Results

3.1. Development and Optimization of Multiplex RT-PCR

One newly designed primer pair for CLas and three published primer sets for CTV, CTLV, and CEVd were used for multiplex RT-PCR. Specific amplicons with expected product sizes (120 bp for CTLV, 196 bp for CEVd, 295 bp for CLas, and 468 bp for CTV) were obtained from the corresponding infected samples (Figure 2). The multiplex RT-PCR amplification of the artificially mixed total nucleic acids of the infected plants did not show any nonspecific band. No amplification products were observed in the healthy and negative control. The amplicons were later cloned into pCR2.1-TOPO for sequencing analysis. All of the sequences obtained were aligned to the related pathogens with high identity using BLAST, thus confirming the specificity of this multiplex RT-PCR assay (Table S1).
For optimizing the multiplex RT-PCR, the annealing temperature and the concentrations of primer sets were tested using the same number of purified plasmids (containing specific amplicons) mixed with the total nucleic acids of healthy citrus plants. Figure 3a shows the effect of different annealing temperatures (56 °C, 58 °C, and 60 °C) on amplification. The band intensities of amplicons were weaker with the increase in the annealing temperature. The amplifications of 196 bp CEVd and 468 bp CTV were decreased at annealing temperatures of 58 °C and 60 °C, respectively. Therefore, the optimal thermal cycling conditions were as follows: 1 cycle at 95 °C for 5 min; 40 cycles at 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 10 min. Six combinations of different concentrations of primer sets were subjected to multiplex RT-PCR for evaluation. Consistent amplification was observed with 0.4 µM of CLas-295F/R, 0.4 µM of CTV-468F/R, 0.4 µM of CTLV-120F/R, and 0.2 µM of CEVd-196F/R (Figure 3b).

3.2. Sensitivity Test

The sensitivity of the multiplex RT-PCR assay was determined by using purified plasmids (104 to 100 copies) diluted using the total nucleic acids of healthy citrus plants. The detection limits for CLas, CTV, CTLV, and CEVd were 101 copies, 102 copies, 102 copies, and 102 copies, respectively (Figure 4). Using the 10-fold dilution of the total nucleic acids from the infected plants, the sensitivity of the simplex RT-PCR and multiplex RT-PCR were compared. CLas, CTV, CTLV, and CEVd were positive at the highest dilution of 10−3, 10−2, 10−2, and 10−3 using simplex RT-PCR, respectively. The detection sensitivity of multiplex RT-PCR decreased for CEVd (Figure 5).

3.3. Detection of CLas, CTV, CTLV, and CEVd from Field Samples

To validate the multiplex RT-PCR developed in this study, 230 citrus samples were randomly collected for detection from orchards during 2021–2023 (Figure 6 and Table 2). These samples were also subjected to the published simplex PCR and RT-PCR assays currently used in Taiwan for comparing the performance of detection [18,21,22,23]. The detection results are shown in Table 2. CLas, CTV, CTLV, and CEVd were detected in 70/230 (30.4%), 77/230 (33.5%), 92/230 (40.0%), and 28/230 (12.2%), respectively, using multiplex RT-PCR. In comparison, the detection results of CLas, CTV, CTLV, and CEVd using the published assays were 58/230 (25.2%), 77/230 (33.5%), 79/230 (34.3%), and 28/230 (12.2%), respectively. The positive detections using the published assays were all in agreement with those of the multiplex RT-PCR. The infection rates varied with pathogens and citrus cultivars. For CLas, the highest infection rate of 43.8% was detected in Ponkan mandarin. Tonkan tangor was the cultivar with the highest rates of CTV (45.9%) and CTLV (48.6%) infection. The CEVd infection rate of 21.1% in Murcott tangor was the highest. Most of the disease samples (121 samples of positive detection) were infected by a single pathogen. The highest rates of single infection by CLas, CTV, CTLV, and CEVd were observed at 18.8% in Ponkan mandarin, 23.7% in Murcott tangor, 32.4% in Tankan tangor, and 15.0% in Eureka lemon (Table 3). As shown in Table 3, mixed infections were frequently found in field samples, with an average of 30.0%. Co-infection with CLas and CTV was the most found among the mixed infection samples. A few samples were co-infected by more than two pathogens (six samples with CLas, CTV, and CTLV; two samples with CTV, CTLV, and CEVd). In addition, there was no mixed infection with four pathogens found in all samples.

3.4. Detection of CLas, CTV, CTLV, and CEVd from Citrus Seedling Samples

A total of 100 citrus seedling samples collected from three different seedling orchards, namely cultivars Ponkan mandarin, Wentan pomelo, and Eureka lemon, were subjected to detection using the developed multiplex RT-PCR. The results are summarized in Table 4. Samples from seedling orchards 1 and 3 were commonly infected (12/20 in Ponkan mandarin, 9/20 in Wentan pomelo, and 10/20 in Eureka lemon). In contrast, the infected samples were much fewer in seedling orchard 2 (1/20 of Wentan pomelo with CLas, 1/20 of Ponkan mandarin with CTV, and 1/20 of Ponkan mandarin with CTLV).

4. Discussion

PCR-based techniques are commonly used for the detection of pathogens in several crops. A multiplex RT-PCR assay was developed in this study for the simultaneous detection of CLas, CTV, CTLV, and CEVd in citrus plants. The specificity and sensitivity of the multiplex RT-PCR were evaluated, and this method demonstrated high performance in the detection of field samples collected from 2021 to 2023.
For the establishment of multiplex RT-PCR, one newly designed primer pair for CLas and three published primer pairs for CTV, CTLV, and CEVd were used. The 16S rRNA and 16S-23S spacer region are commonly used for CLas-specific primers design; however, this region showed homology with plant genomic DNA and was therefore not chosen for primer design in this study [32]. The primer pair for CLas in this study targeted the trmU-tufB-secE-nusG-rplKAJL-rpoB gene cluster region. Tomimura et al. analyzed this gene cluster region among 31 CLas isolates from Asia (including Japan, Taiwan, Vietnam, Thailand, and Indonesia) and found that there were only a few nucleotide differences in the 9.6 kb cluster sequences [33]. This region is a highly conserved gene cluster region among CLas and was proven to be CLas-specific by Feng et al. [32,34]. The sequences of amplified products were highly identical to corresponding pathogens (Table S1), also supporting the specificity of multiplex RT-PCR. Recently, some reports revealed that phytoplasma was associated with HLB in Asia, such as Chinese Huanglongbing disease (CHD)-associated phytoplasma (16SrI) and Citrus blotchy-mottle (CBM) phytoplasma (16SrII) [35,36]. In Taiwan, a phytoplasma named “Taiwan citrus symptomless (TCS) phytoplasma” (16SrII) was found that could infect Wentan pomelo with no symptoms [37]. Our test showed no cross-reaction between the primer pair designed in this study and TCS phytoplasma (Figure S1). The unexpected amplification of multiplex PCR and RT-PCR may be caused by several factors such as annealing temperature and primer combinations; thus, the optimization of amplification conditions is essential for multiplex PCR and RT-PCR development [38,39]. Because there are more than one primer pair in a reaction, the interactions among different primers not only cause competition of reaction components but also may cause nonspecific products (e.g., primer dimers). Elnifro et al. reported that the specificity and sensitivity of multiplex PCR and RT-PCR were primarily decreased due to nonspecific product formation [39]. For the developed multiplex RT-PCR amplification, optimum results were obtained with 56 °C annealing temperature and primer concentrations of 0.4 µM for CLas, 0.4 µM for CTV, 0.4 µM for CTLV, and 0.2 µM for CEVd. The sensitivity evaluation showed that CLas, CTV, CTLV, and CEVd could be detected as low as 10, 100, 100, and 100 copies per reaction, respectively. Previous studies revealed that many viruses and bacteria were low titers and uneven distribution in host plants, causing difficulties in detection [40,41]. In the comparison of the field detections of multiplex RT-PCR and published simplex assays [18,21,22,23] for the four citrus systemic diseases, more positive detections of CLas and CTLV were found using multiplex RT-PCR. These positive detections were confirmed via sequencing. An additional evaluation showed that the detection limits of CLas and CTLV using multiplex RT-PCR were approximately 10-fold higher than those of the published simplex assays (Figure 5 and Figure S2), indicating the better detection performance of the multiplex RT-PCR assay developed in this study.
Using the developed multiplex RT-PCR, the detections of field samples revealed the incidence of these four citrus systemic diseases. The infection rates of CLas, CTV, CTLV, and CEVd were 30.4%, 33.5%, 40.0%, and 12.2%, respectively. The highest detection rates of CTLV may result from its characteristics of latent infection in most commercial citrus cultivars in Taiwan [23]. CTLV-infected plants with no symptoms are easily omitted by farmers and then form hidden inoculums in fields. CTV showed a wide range of infection rates among different cultivars (14.3% to 45.9%). The low percentage of CTV infection in Wentan pomelo is related to the host limitation of CTV strains. In Taiwan, only the CTV pummelo stem-pitting strain (CTV-Pum/SP) can infect the cultivar Wentan pomelo [4]. CLas is also an epidemic in Taiwan, and it was found to have relatively similar infection rates within the cultivars surveyed in this study. The predominant CLas strain (Strain II) infects all citrus cultivars [9]. The highest percentage of the infected samples was present in the cultivar Liucheng sweet orange, and the lowest was in Wentan pomelo. Our results indicated that the infection rate was not associated only with cultivar susceptibility. For example, Tonkan tangor, the CLas susceptible cultivar, was found to be less infected with CLas in field samples. This may be because the Tonkan tangor plants are easily declined by CLas infection after several years, thus resulting in maintaining a low infection rate.
Disease seedlings play a critical role in spreading pathogens in fields. Our results showed that these four systemic pathogens were present in commercial seedlings, which correlated with the common occurrences in fields observed in this study. The disease incidences of seedlings were significantly affected due to management practices. The farmers of seedling orchard 2 regularly removed the seedlings with disease-like symptoms and properly disinfected the cutting tools; therefore, there were only a few percentages of CLas, CTV, and/or CTLV infections found in orchard 2 compared with other seedling orchards. Mixed infections were found in an average of 30.0% of the field samples in this study. The interactions between pathogens are important issues for disease development. For CLas and CTV co-infection, a synergistic effect of weakening the sweet orange plants was observed, and the transcriptional data showed different expressions of the host’s genes about cell wall modification, metal transport, phloem proteins, and sucrose-loading proteins compared with single infection [42]. The study by Lai also demonstrated that the co-infection of CLas and CTV caused more severe symptoms in the cultivar Ponkan mandarin [31]. Additionally, the number of pathogens may be influenced by mixed infection. Increasing citrus dwarfing viroid (CDVd) titer via CTV co-infection was demonstrated by Serra et al. [43]. Levels of virus titer are sometimes associated with transmission rates. The cucurbit yellow stunting disorder virus (CYSDV, belonging to the family Closteroviridae) was found to have higher titers in cucurbit plants and showed higher transmission rates than noncucurbit hosts [44]. Further experiments on the host’s responses to different infection statuses are needed to understand the disease ecology. To our knowledge, this is the first survey of the four systemic diseases in Taiwan. Although sample collection was not carried out in all citrus cultivars and planting regions, our survey provides information for improving the strategies for disease management.
The strategies for the control of the four major citrus systemic diseases rely on prevention methods, such as using resistant/tolerant cultivars, implementing a healthy seedling system, eliminating infected plants, and preventing insect vectors [4,45]. Therefore, specific and sensitive detection tools are required. When mass quantities of samples need to be assayed, ELISA is a cost-efficient method for detection. However, this method is less reliable for detecting samples with low titer of pathogens [46]. Moreover, the reliability of ELISA usually depends on sample conditions and the quality of the antibody [47]. Hung et al. demonstrated that CTV in dried plant materials could be detected using RT-PCR but was negative in ELISA tests [22]. PCR and RT-PCR are more reliable and sensitive for detection. A two-step RT-PCR showed 10-fold more sensitivity than ELISA for CTV detection [48]. Achachi et al. compared ELISA and RT-PCR for citrus psorosis virus (CPsV), and their results revealed that RT-PCR was more sensitive and consistent in field-collected samples [49]. The incubation period of certain pathogens such as CLas can be several months to years with low pathogen levels, and these infected trees are potential sources for disease spread [50]. Therefore, sensitive detection may help to detect latent infection before it leads to widespread disease in fields, and/or facilitate the conservation of healthy stock citrus cultivars. Currently, many multiplex PCR and RT-PCR assays have been developed for citrus. Ito et al. demonstrated a simultaneous detection of six citrus viroids (including CEVd) and CTLV [51]. A multiplex PCR assay was described by Roy et al. for seven citrus viruses, including CTLV and CTV [26]. Hyun et al. developed a multiplex PCR for the detection of four citrus viruses (including CTLV and CTV), and one multiplex PCR was also developed for CLas and four viruses including CTV in citrus [30,52]. All of these studies suggested that the multiplex PCR and RT-PCR assays would be useful in citrus budwood certification programs and disease control. Recently, multiplex quantitative PCR (qPCR) and reverse transcription–quantitative PCR (RT-qPCR) assays were developed for several citrus pathogens [53,54,55,56]. These detection assays exhibited high performance with higher levels of sensitivity than conventional PCR and RT-PCR; however, the cost of the qPCR and RT-qPCR techniques might be a concern for certain laboratories. In recent decades, the healthy seedling system of citrus was officially implemented in Taiwan. However, currently, the demand for certified healthy citrus seedlings exceeds the supply due to the costs of indexing. Compared with conducting four individual simplex assays, the multiplex RT-PCR developed in this study can save considerable cost, labor, and time to help the production of healthy seedlings.
In conclusion, a multiplex RT-PCR assay for the specific detection of four economically important citrus systemic diseases was developed in this study, and the high sensitivities of this assay were also demonstrated. This method will be a powerful tool to detect infection in fields and seedling nurseries. A further large-scale field survey of the citrus systemic diseases using this multiplex RT-PCR with more citrus cultivars and more planting regions in Taiwan will provide more information on the epidemiology and also benefit the establishment of better-integrated disease management.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture13061227/s1, Table S1: The sequences and alignments of amplified products; Figure S1: An additional test of specificity of the newly designed primer pair for Candidatus Liberibacter asiaticus (CLas); Figure S2: Sensitivities of compared simplex RT-PCR for citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and Candidatus Liberibacter asiaticus (CLas) using 10-fold serial dilutions of total nucleic acids from infected plants.

Author Contributions

Conceptualization, S.-M.Y. and T.-H.H.; methodology, S.-M.Y.; validation, M.-L.W. and T.-H.H.; formal analysis, S.-M.Y.; investigation, S.-M.Y.; resources, M.-L.W. and T.-H.H.; data curation, M.-L.W. and T.-H.H.; writing—original draft preparation, S.-M.Y.; writing—review and editing, M.-L.W. and T.-H.H.; visualization, S.-M.Y.; supervision, T.-H.H.; project administration, T.-H.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors are grateful to the citrus farmers of Taiwan for the kind supply of several citrus samples to complete this study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Food and Agriculture Organization of the United Nations. Citrus. Available online: https://www.fao.org/markets-and-trade/commodities/citrus/en/ (accessed on 28 December 2022).
  2. Food and Agriculture Organization of the United Nations. Citrus Fruit Statistical Compendium 2020. Available online: https://www.fao.org/markets-and-trade/publications/detail/en/c/1438250/ (accessed on 28 December 2022).
  3. Council of Agriculture. Agricultural Statistics Yearbook; Council of Agriculture: Taipei, Taiwan, 2021; pp. 74–81.
  4. Su, H.J. Production and Cultivation of Virus-Free Citrus Saplings for Citrus Rehabilitation in Taiwan; Asia-Pacific Consortium on Agricultural Biotechnology and Asia-Pacific Association of Agricultural Research Institutions: Bangkok, Thailand, 2008. [Google Scholar]
  5. Huang, A.L. Electronmicroscopical Studies on the Morphology and Population Dynamic of Fastidious Bacteria Causing Citrus Likubin. Ph.D. Thesis, National Taiwan University, Taipei, Taiwan, 1987. [Google Scholar]
  6. Bové, J.M. Huanglongbing: A destructive, newly-emerging, century-old disease of citrus. J. Plant Pathol. 2006, 88, 7–37. [Google Scholar]
  7. Su, H.J. Research and health management of citrus Huanglongbing in Taiwan. In Proceedings of the International Research Conference on Huanglongbing, Orlando, FL, USA, 1–5 December 2008. [Google Scholar]
  8. Capoor, S.P.; Rao, D.G.; Viswanath, S.M. Diaphorina citri Kuwayama, a vector of the greening disease of citrus in India. Indian J. Agric. Sci. 1967, 37, 572–576. [Google Scholar]
  9. Tsai, C.H.; Hung, T.H.; Su, H.J. Strain identification and distribution of citrus Huanglongbing bacteria in Taiwan. Bot. Stud. 2008, 49, 49–56. [Google Scholar]
  10. Karasev, A.V.; Boyko, V.P.; Gowda, S.; Nikolaeva, O.V.; Hilf, M.E.; Koonin, E.V.; Niblett, C.L.; Cline, K.; Gumpf, D.J.; Lee, R.F.; et al. Complete sequence of the citrus tristeza virus RNA genome. Virology 1995, 208, 511–520. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  11. Bar-Joseph, M.; Marcus, R.; Lee, R.F. The continuous challenge of citrus tristeza virus control. Annu. Rev. Phytopathol. 1989, 27, 291–316. [Google Scholar] [CrossRef]
  12. Martelli, G.P.; Abou Ghanem-Sabanadzovic, N.; Agranovsky, A.A.; Al Rwahnih, M.; Dolja, V.V.; Dovas, C.I.; Fuchs, M.; Gugerli, P.; Hu, J.S.; Jelkmann, W.; et al. Taxonomic revision of the family Closteroviridae with special reference to the grapevine leafroll-associated members of the genus Ampelovirus and the putative species unassigned to the family. J. Plant Pathol. 2012, 94, 7–19. [Google Scholar]
  13. Folimonova, S.Y. Citrus tristeza virus: A large RNA virus with complex biology turned into a valuable tool for crop protection. PLoS Pathog. 2020, 16, e1008416. [Google Scholar] [CrossRef]
  14. Martelli, G.P.; Adams, M.J.; Kreuze, J.F.; Dolja, V.V. Family Flexiviridae: A case study in virion and genome plasticity. Annu. Rev. Phytopathol. 2007, 45, 73–100. [Google Scholar] [CrossRef] [Green Version]
  15. Tatineni, S.; Afunian, M.R.; Hilf, M.E.; Gowda, S.; Dawson, W.O.; Garnsey, S.M. Molecular characterization of Citrus tatter leaf virus historically associated with Meyer lemon tree: Complete genome sequence and development of biologically active in vitro transcripts. Phytopathology 2009, 99, 423–431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Garnsey, S.M. Mechanical transmission of a virus that produces tatter leaf symptoms in Citrus excelsa. In Proceedings of the 6th Conference of the International Organization of Citrus Virologists; Weathers, L.G., Cohen, M., Eds.; IOCV: Riverside, CA, USA, 1974; p. 137. [Google Scholar]
  17. Zhang, T.M.; Liang, X.Y.; Roistacher, C.N. Occurrence and detection of citrus tatter leaf virus (CTLV) in Huangyan, Zhejiang Province, China. Plant Dis. 1988, 72, 543–545. [Google Scholar] [CrossRef]
  18. Lin, C.Y.; Wu, M.L.; Shen, T.L.; Yeh, H.H.; Hung, T.H. Multiplex detection, distribution, and genetic diversity of Hop stunt viroid and Citrus exocortis viroid infecting citrus in Taiwan. Virol. J. 2015, 12, 11. [Google Scholar] [CrossRef] [Green Version]
  19. Duran-Vila, N.; Flores, R.; Semancik, J.S. Characterization of viroidlike RNAs associated with the citrus exocortis syndrome. Virology 1986, 150, 75–84. [Google Scholar] [CrossRef]
  20. Tsai, M.C.; Su, H.J. Development and characterization of monoclonal antibodies to citrus tristeza virus (CTV) strains in Taiwan. In Proceedings of the 11th Conference of the International Organization of Citrus Virologists; Brlansky, R.H., Lee, R.F., Eds.; IOCV: Riverside, CA, USA, 1991; pp. 46–50. [Google Scholar]
  21. Hung, T.H.; Wu, M.L.; Su, H.J. Development of a rapid method for the diagnosis of citrus greening disease using the polymerase chain reaction. J. Phytopathol. 1999, 147, 599–604. [Google Scholar] [CrossRef]
  22. Hung, T.H.; Wu, M.L.; Su, H.J. A rapid method based on the one-step reverse transcriptase-polymerase chain reaction (RT-PCR) technique for detection of different strains of citrus tristeza virus. J. Phytopathol. 2000, 148, 469–475. [Google Scholar] [CrossRef]
  23. Lin, C.Y.; Chang, L.; Lin, Y.H.; Cheng, H.L.; Wu, M.L.; Hung, T.H. Biological and molecular characterization of citrus tatter leaf virus in Taiwan. Plant Pathol. 2018, 67, 995–1008. [Google Scholar] [CrossRef] [Green Version]
  24. Garnsey, S.M.; Cambra, M. Enzyme-linked immunosorbent assay (ELISA) for citrus pathogens. In Graft Transmissible Diseases of Citrus. Handbook for Detection and Diagnosis; Roistacher, C.N., Ed.; FAO: Rome, Italy, 1991; pp. 193–216. [Google Scholar]
  25. Pallás, V.; Sánchez-Navarro, J.A.; James, D. Recent advances on the multiplex molecular detection of plant viruses and viroids. Front. Microbiol. 2018, 9, 2087. [Google Scholar] [CrossRef] [Green Version]
  26. Roy, A.; Fayad, A.; Barthe, G.; Brlansky, R.H. A multiplex polymerase chain reaction method for reliable, sensitive and simultaneous detection of multiple viruses in citrus trees. J. Virol. Meth. 2005, 129, 47–55. [Google Scholar] [CrossRef] [PubMed]
  27. Digiaro, M.; Elbeaino, T.; Martelli, G.P. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroup A, B and C. J. Virol. Meth. 2007, 141, 34–40. [Google Scholar] [CrossRef] [PubMed]
  28. Dai, J.; Cheng, J.; Huang, T.; Zheng, X.; Wu, Y. A multiplex reverse transcription PCR assay for simultaneous detection of five tobacco viruses in tobacco plants. J. Virol. Meth. 2012, 183, 57–62. [Google Scholar] [CrossRef] [PubMed]
  29. Tuo, D.; Shen, W.; Yang, Y.; Yan, P.; Li, X.; Zhou, P. Development and validation of a multiplex reverse transcription PCR assay for simultaneous detection of three papaya virus. Viruses 2014, 6, 3893–3906. [Google Scholar] [CrossRef] [Green Version]
  30. Hyun, J.W.; Hwang, R.Y.; Jung, K.E. Development of multiplex PCR for simultaneous detection of citrus viruses and incidence of citrus viral diseases in late-maturity citrus trees in Jeju Island. Plant Pathol. J. 2017, 33, 307–317. [Google Scholar] [CrossRef] [Green Version]
  31. Lai, Q.J. Study on the Important Citrus Cultivars Co-Infected by Candidatus Liberibacter Asiaticus and Citrus Tristeza Virus in Taiwan. Master’s Thesis, National Taiwan University, Taipei, Taiwan, 2014. [Google Scholar]
  32. Okuda, M.; Matsumoto, M.; Tanaka, Y.; Subandiyah, S.; Iwanami, T. Characterization of the tufB-secE-nusG-rplKAJL-rpoB gene cluster of the citrus greening organism and detection by loop-mediated isothermal amplification. Plant Dis. 2005, 89, 705–711. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Tomimura, K.; Miyata, S.; Furuya, N.; Kubota, K.; Okuda, M.; Subandiyah, S.; Hung, T.H.; Su, H.J.; Iwanami, T. Evaluation of genetic diversity of ‘Candidatus Liberibacter asiaticus’ isolates collected in Southeast Asia. Phytopathology 2009, 99, 1062–1069. [Google Scholar] [CrossRef] [Green Version]
  34. Feng, Y.C.; Tsai, C.H.; Vung, S.; Hung, T.H.; Su, H.J. Cochin China atalantia (Atalantia citroides) as a new alternative host of the bacterium causing citrus Huanglongbing. Australas. Plant Pathol. 2015, 44, 71–80. [Google Scholar] [CrossRef]
  35. Chen, J.; Pu, X.; Liu, S.; Li, H.; Civerolo, E. A phytoplasma related to “Candidatus Phytoplasma asteris” detected in citrus showing huanglongbing (yellow shoot disease) symptoms in Guangdong, PR China. Phytopathology 2009, 99, 236–242. [Google Scholar] [CrossRef] [Green Version]
  36. Lou, B.H.; Bai, X.J.; Bai, Y.; Deng, C.L.; RoyChowdhury, M.; Chen, C.W.; Song, Y.Q. Detection and molecular characterization of a 16SrII-A* phytoplasma in grapefruit (Citrus paradisi) with huanglongbing-like symptoms in China. J. Phytopathol. 2014, 162, 387–395. [Google Scholar] [CrossRef]
  37. Feng, Y.C.; Hung, T.H.; Su, H.J. Detection and inoculation of peanut witches’ broom phytoplasma (16SrII-A) and periwinkle leaf yellowing phytoplasma (16SrI-B) in citrus cultivars in Taiwan. J. Phytopathol. 2015, 163, 364–375. [Google Scholar] [CrossRef]
  38. Wei, T.; Lu, G.; Clover, G. Novel approaches to mitigate primer interaction and eliminate inhibitors in multiplex PCR, demonstrated using an assay for detection of three strawberry viruses. J. Virol. Methods 2008, 151, 132–139. [Google Scholar] [CrossRef] [PubMed]
  39. Elnifro, E.M.; Ashshi, A.M.; Cooper, R.J.; Klapper, P.E. Multiplex PCR: Optimization and application in diagnostic virology. Clin. Microbiol. Rev. 2000, 13, 559–570. [Google Scholar] [CrossRef]
  40. Li, S.F.; Onodera, S.; Sano, T.; Yoshida, K.; Wang, G.P.; Shikata, E. Gene diagnosis of viroids: Comparisons of return-PAGE and hybridization using DIG-labeled DNA and RNA probes for practical diagnosis of Hop stunt, Citrus exocortis and Apple scar skin viroids in their natural host plants. Ann. Phytopathol. Soc. Jpn. 1995, 61, 381–390. [Google Scholar] [CrossRef]
  41. Li, W.B.; Levy, L.; Hartung, J.S. Quantitative distribution of ‘Candidatus Liberibacter asiaticus’ in citrus plants with citrus huanglongbing. Phytopathology 2009, 99, 139–144. [Google Scholar] [CrossRef] [Green Version]
  42. Fu, S.; Shao, J.; Paul, C.; Zhou, C.; Hartung, J.S. Transcriptional analysis of sweet orange trees co-infected with ‘Candidatus Liberibacter asiaticus’ and mild or severe strains of Citrus tristeza virus. BMC Genom. 2017, 18, 837. [Google Scholar] [CrossRef] [Green Version]
  43. Serra, P.; Hashemian, S.M.B.; Fagoaga, C.; Romero, J.; Ruiz-Ruiz, S.; Gorris, M.T.; Bertolini, E.; Duran-Vila, N. Virus-viroid interactions: Citrus tristeza virus enhances the accumulation of Citrus dwarfing viroid in Mexican lime via virus-encoded silencing suppressors. J. Virol. 2014, 88, 1394–1397. [Google Scholar] [CrossRef] [Green Version]
  44. Wintermantel, W.M.; Gilbertson, R.L.; McCreight, J.D.; Natwick, E.T. Host-specific relationship between virus titer and whitefly transmission of Cucurbit yellow stunting disorder virus. Plant Dis. 2016, 100, 92–98. [Google Scholar] [CrossRef] [Green Version]
  45. Lin, C.Y.; Tsai, C.H.; Tien, H.J.; Wu, M.L.; Su, H.J.; Hung, T.H. Quantification and ecological study of ‘Candidatus Liberibacter asiaticus’ in citrus hosts, rootstocks and the Asian citrus psyllid. Plant Pathol. 2017, 66, 1555–1568. [Google Scholar] [CrossRef]
  46. Canning, E.S.; Penrose, M.J.; Barker, I.; Coates, D. Improved detection of Barley yellow dwarf virus in single aphids using RT-PCR. J. Virol. Methods 1996, 56, 191–197. [Google Scholar] [CrossRef]
  47. Martin, R.R.; James, D.; Lévesque, C.A. Impacts of molecular diagnostic technologies on plant disease management. Annu. Rev. Phytopathol. 2000, 38, 207–239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Saponari, M.; Manjunath, K.; Yokomi, R.K. Quantitative detection of Citrus tristeza virus in citrus and aphids by real-time reverse transcription-PCR (TaqMan®). J. Virol. Methods 2008, 147, 43–53. [Google Scholar] [CrossRef] [PubMed]
  49. Achachi, A.; Jijakli, M.H.; Fahime, E.E.; Soulaymani, A.; Ibriz, M. Detection of Citrus psorosis virus using an improved one-step RT-PCR. Arab. J. Sci. Eng. 2015, 40, 7–13. [Google Scholar] [CrossRef]
  50. Gottwald, T.R. Current epidemiological understanding of citrus Huanglongbing. Annu. Rev. Phytopathol. 2010, 48, 119–139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Ito, T.; Ieki, H.; Ozaki, K. Simultaneous detection of six citrus viroids and apple stem grooving virus from citrus plants by multiplex reverse transcription polymerase chain reaction. J. Virol. Methods 2002, 106, 235–239. [Google Scholar] [CrossRef]
  52. Meena, R.P.; Baranwal, V.K. Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees. J. Virol. Methods 2016, 235, 58–64. [Google Scholar] [CrossRef] [PubMed]
  53. Saponari, M.; Loconsole, G.; Liao, H.H.; Jiang, B.; Savino, V.; Yokomi, R.K. Validation of high-throughput real time polymerase chain reaction assays for simultaneous detection of invasive citrus pathogens. J. Virol. Methods 2013, 193, 478–486. [Google Scholar] [CrossRef] [PubMed]
  54. Osman, F.; Hodzic, E.; Kwon, S.J.; Wang, J.; Vidalakis, G. Development and validation of a multiplex reverse transcription quantitative PCR (RT-qPCR) assay for the rapid detection of Citrus tristeza virus, Citrus psorosis virus, and Citrus leaf blotch virus. J. Virol. Methods 2015, 220, 64–75. [Google Scholar] [PubMed] [Green Version]
  55. Osman, F.; Dang, T.; Bodaghi, S.; Vidalakis, G. One-step multiplex RT-qPCR detects three citrus viroids from different genera in a wide range of hosts. J. Virol. Methods 2017, 245, 40–52. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Maheshwari, Y.; Selvaraj, V.; Godfrey, K.; Hajeri, S.; Yokomi, R. Multiplex detection of “Candidatus Liberibacter asiaticus” and Spiroplasma citri by qPCR and droplet digital PCR. PLoS ONE 2021, 16, e0242392. [Google Scholar]
Agriculture 13 01227 g001 550
Figure 1. Localization of the newly designed primer pair for Candidatus Liberibacter asiaticus (CLas). The orange arrow stick represents the forward primer (CLas-295F), and the purple arrow stick is the reverse primer (CLas-295R). The numbers indicate the primers targeting the position of sequences (Accession No. AB480136.1).
Figure 1. Localization of the newly designed primer pair for Candidatus Liberibacter asiaticus (CLas). The orange arrow stick represents the forward primer (CLas-295F), and the purple arrow stick is the reverse primer (CLas-295R). The numbers indicate the primers targeting the position of sequences (Accession No. AB480136.1).
Agriculture 13 01227 g001
Agriculture 13 01227 g002 550
Figure 2. Detection of Candidatus Liberibacter asiaticus (CLas), citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and citrus exocortis viroid (CEVd) in citrus using multiplex RT-PCR. The amplicons were 120 bp for CTLV, 196 bp for CEVd, 295 bp for CLas, and 468 bp for CTV. Lane 1: CTLV-infected citrus plant; Lane 2: CEVd-infected citrus plant; Lane 3: CLas-infected citrus plant; Lane 4: CTV-infected citrus plant; Lane 5: mixed nucleic acids of infected citrus plant with CLas, CTV, CTLV, and CEVd; H, healthy control; M, 100 bp DNA ladder (GeneDireX); N, negative control (ddH2O).
Figure 2. Detection of Candidatus Liberibacter asiaticus (CLas), citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and citrus exocortis viroid (CEVd) in citrus using multiplex RT-PCR. The amplicons were 120 bp for CTLV, 196 bp for CEVd, 295 bp for CLas, and 468 bp for CTV. Lane 1: CTLV-infected citrus plant; Lane 2: CEVd-infected citrus plant; Lane 3: CLas-infected citrus plant; Lane 4: CTV-infected citrus plant; Lane 5: mixed nucleic acids of infected citrus plant with CLas, CTV, CTLV, and CEVd; H, healthy control; M, 100 bp DNA ladder (GeneDireX); N, negative control (ddH2O).
Agriculture 13 01227 g002
Agriculture 13 01227 g003 550
Figure 3. Optimization of multiplex RT-PCR. The amplicons were 120 bp for citrus tatter leaf virus (CTLV), 196 bp for citrus exocortis viroid (CEVd), 295 bp for Candidatus Liberibacter asiaticus (CLas), and 468 bp for citrus tristeza virus (CTV): (a) annealing temperature optimization. Lanes 1–3: purified plasmids containing specific amplicons mentioned above (mixed with the total nucleic acids of healthy citrus plants) as templates; Lanes 4–6: negative controls (empty pCR2.1-TOPO vector with the total nucleic acids of healthy citrus plants); Lane 1: 56 °C; Lane 2: 58 °C; Lane 3: 60 °C; Lane 4: 56 °C; Lane 5: 58 °C; Lane 6: 60 °C; (b) primer sets concentration optimization. Lanes 1–6: purified plasmids containing specific amplicons mentioned above (mixed with the total nucleic acids of healthy citrus plants) as templates; Lanes 7–12: negative controls (empty pCR2.1-TOPO vector with the total nucleic acids of healthy citrus plants); the concentrations of primer pairs for CLas, CTV, CTLV, and CEVd were Lanes 1 and 7: 0.2, 0.2, 0.2, and 0.2 µM; Lanes 2 and 8: 0.4, 0.2, 0.4, and 0.4 µM; Lanes 3 and 9: 0.2, 0.4, 0.4, and 0.4 µM; Lanes 4 and 10: 0.4, 0.4, 0.4, and 0.2 µM; Lanes 5 and 11: 0.4, 0.4, 0.2, and 0.4 µM; Lanes 6 and 12: 0.4, 0.4, 0.4, and 0.4 µM; M, 100 bp DNA ladder (GeneDireX).
Figure 3. Optimization of multiplex RT-PCR. The amplicons were 120 bp for citrus tatter leaf virus (CTLV), 196 bp for citrus exocortis viroid (CEVd), 295 bp for Candidatus Liberibacter asiaticus (CLas), and 468 bp for citrus tristeza virus (CTV): (a) annealing temperature optimization. Lanes 1–3: purified plasmids containing specific amplicons mentioned above (mixed with the total nucleic acids of healthy citrus plants) as templates; Lanes 4–6: negative controls (empty pCR2.1-TOPO vector with the total nucleic acids of healthy citrus plants); Lane 1: 56 °C; Lane 2: 58 °C; Lane 3: 60 °C; Lane 4: 56 °C; Lane 5: 58 °C; Lane 6: 60 °C; (b) primer sets concentration optimization. Lanes 1–6: purified plasmids containing specific amplicons mentioned above (mixed with the total nucleic acids of healthy citrus plants) as templates; Lanes 7–12: negative controls (empty pCR2.1-TOPO vector with the total nucleic acids of healthy citrus plants); the concentrations of primer pairs for CLas, CTV, CTLV, and CEVd were Lanes 1 and 7: 0.2, 0.2, 0.2, and 0.2 µM; Lanes 2 and 8: 0.4, 0.2, 0.4, and 0.4 µM; Lanes 3 and 9: 0.2, 0.4, 0.4, and 0.4 µM; Lanes 4 and 10: 0.4, 0.4, 0.4, and 0.2 µM; Lanes 5 and 11: 0.4, 0.4, 0.2, and 0.4 µM; Lanes 6 and 12: 0.4, 0.4, 0.4, and 0.4 µM; M, 100 bp DNA ladder (GeneDireX).
Agriculture 13 01227 g003
Agriculture 13 01227 g004 550
Figure 4. Sensitivity of multiplex RT-PCR. The amplicons were 120 bp for citrus tatter leaf virus (CTLV), 196 bp for citrus exocortis viroid (CEVd), 295 bp for Candidatus Liberibacter asiaticus (CLas), and 468 bp for citrus tristeza virus (CTV). Lane 1: 104 copies of purified plasmids; Lane 2: 103 copies of purified plasmids; Lane 3: 102 copies of purified plasmids; Lane 4: 101 copies of purified plasmids; Lane 5: 100 copies of purified plasmids; M, 100 bp DNA ladder (GeneDireX); N, negative control (ddH2O).
Figure 4. Sensitivity of multiplex RT-PCR. The amplicons were 120 bp for citrus tatter leaf virus (CTLV), 196 bp for citrus exocortis viroid (CEVd), 295 bp for Candidatus Liberibacter asiaticus (CLas), and 468 bp for citrus tristeza virus (CTV). Lane 1: 104 copies of purified plasmids; Lane 2: 103 copies of purified plasmids; Lane 3: 102 copies of purified plasmids; Lane 4: 101 copies of purified plasmids; Lane 5: 100 copies of purified plasmids; M, 100 bp DNA ladder (GeneDireX); N, negative control (ddH2O).
Agriculture 13 01227 g004
Agriculture 13 01227 g005 550
Figure 5. Comparison of sensitivity between simplex RT-PCR and multiplex RT-PCR using 10-fold serial dilution (100 to 10−4) of the total nucleic acids from infected plants. The amplicons were 120 bp for citrus tatter leaf virus (CTLV), 196 bp for citrus exocortis viroid (CEVd), 295 bp for Candidatus Liberibacter asiaticus (CLas), and 468 bp for citrus tristeza virus (CTV). Lane 1: 100; Lane 2: 10−1; Lane 3: 10−2; Lane 4: 10−3; Lane 5: 10−4; M, 100 bp DNA ladder (GeneDireX); N, negative control (ddH2O).
Figure 5. Comparison of sensitivity between simplex RT-PCR and multiplex RT-PCR using 10-fold serial dilution (100 to 10−4) of the total nucleic acids from infected plants. The amplicons were 120 bp for citrus tatter leaf virus (CTLV), 196 bp for citrus exocortis viroid (CEVd), 295 bp for Candidatus Liberibacter asiaticus (CLas), and 468 bp for citrus tristeza virus (CTV). Lane 1: 100; Lane 2: 10−1; Lane 3: 10−2; Lane 4: 10−3; Lane 5: 10−4; M, 100 bp DNA ladder (GeneDireX); N, negative control (ddH2O).
Agriculture 13 01227 g005
Agriculture 13 01227 g006 550
Figure 6. Detection of Candidatus Liberibacter asiaticus (CLas), citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and citrus exocortis viroid (CEVd) in field citrus samples (cultivar Ponkan mandarin) using multiplex RT-PCR. The amplicons were 120 bp for CTLV, 196 bp for CEVd, 295 bp for CLas, and 468 bp for CTV. Lanes 1–13: field samples; H, healthy control; M, 100 bp DNA ladder (GeneDireX); N, negative control (ddH2O); P, positive control (mixed nucleic acids of infected citrus plant with CLas, CTV, CTLV, and CEVd).
Figure 6. Detection of Candidatus Liberibacter asiaticus (CLas), citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and citrus exocortis viroid (CEVd) in field citrus samples (cultivar Ponkan mandarin) using multiplex RT-PCR. The amplicons were 120 bp for CTLV, 196 bp for CEVd, 295 bp for CLas, and 468 bp for CTV. Lanes 1–13: field samples; H, healthy control; M, 100 bp DNA ladder (GeneDireX); N, negative control (ddH2O); P, positive control (mixed nucleic acids of infected citrus plant with CLas, CTV, CTLV, and CEVd).
Agriculture 13 01227 g006
Table
Table 1. Primers used in multiplex RT-PCR for detecting Candidatus Liberibacter asiaticus, citrus tristeza virus, citrus tatter leaf virus, and citrus exocortis viroid in this study.
Table 1. Primers used in multiplex RT-PCR for detecting Candidatus Liberibacter asiaticus, citrus tristeza virus, citrus tatter leaf virus, and citrus exocortis viroid in this study.
Target aPrimer Name bSequence (5′ to 3′)Amplicon Size (bp)Reference
CLasCLas-295FCGGATGTTCCAAGGGGTAGG295This study
CLas-295RGTCTTTCCTCCTTCACGCA
CTVCTV-468FGGTTACGAGGAAGCAACCG468[31]
CTV-468RCGAGTGTACGTTATGCCCG
CTLVCTLV-120F cGGAGTCGTTTAAAATTCCGC120[23]
CTLV-120RAGAAAAACCACACTAACCCG
CEVdCEVd-196FTTTCGCTGCTGGCTCCACA196[18]
CEVd-196RACCTCAAGAAAGATCCCGA
a CLas, Candidatus Liberibacter asiaticus; CTV, citrus tristeza virus; CTLV, citrus tatter leaf virus; CEVd, citrus exocortis viroid. b F, forward primer; R, reverse primer. c The sequence is complementary to primer CTLV-R-6354.
Table
Table 2. Comparison of field detection of Candidatus Liberibacter asiaticus (CLas), citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and citrus exocortis viroid (CEVd) using multiplex RT-PCR and published assays.
Table 2. Comparison of field detection of Candidatus Liberibacter asiaticus (CLas), citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and citrus exocortis viroid (CEVd) using multiplex RT-PCR and published assays.
Cultivar aNo. of SamplesNo. of Positive Detection (Multiplex RT-PCR/Published assays) b
CLasCTVCTLVCEVd
EL4012/109/915/148/8
TK3710/917/1718/162/2
PK3214/1011/1113/121/1
Mur389/916/1611/108/8
LSO4513/1119/1920/156/6
WP3512/95/515/123/3
U30/00/00/00/0
Total23070/5877/7792/7928/28
a The citrus cultivars collected in this study were Eureka lemon (EL, Citrus limon), Tankan tangor (TK, C. tankan), Ponkan mandarin (PK, C. reticulata), Murcott tangor (Mur, C. reticulate × C. sinensis), Liucheng sweet orange (LSO, C. sinensis), and Wentan pomelo (WP, C. grandis), as well as unknown (U) cultivars. b The published assays used for detections of CLas, CTV, CTLV, and CEVd are described in [18,21,22,23].
Table
Table 3. Infection rates of Candidatus Liberibacter asiaticus (CLas), citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and citrus exocortis viroid (CEVd) in field samples using multiplex RT-PCR.
Table 3. Infection rates of Candidatus Liberibacter asiaticus (CLas), citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and citrus exocortis viroid (CEVd) in field samples using multiplex RT-PCR.
Cultivar aNo. of SamplesCLas OnlyCTV OnlyCTLV OnlyCEVd OnlyMixed Infection
CLas
+
CTV		CLas
+
CTLV		CLas
+
CEVd		CTV
+
CTLV		CLas
+
CTV
+
CTLV		CTV
+
CTLV
+
CEVd
EL4012.5% (5/40)7.5% (3/40)17.5% (7/40)15.0% (6/40)2.5% (1/40)7.5% (3/40)5.0% (2/40)10.0% (4/40)2.5% (1/40)0.0% (0/40)
TK372.7% (1/37)18.9% (7/37)32.4% (12/37)0.0% (0/37)13.5% (5/37)2.7% (1/37)2.7% (1/37)5.4% (2/37)5.4% (2/37)2.7% (1/37)
PK3218.8% (6/32)12.5% (4/32)21.9% (7/32)0.0% (0/32)12.5% (4/32)9.4% (3/32)0.0% (0/32)3.1% (1/32)3.1% (1/32)3.1% (1/32)
Mur385.3% (2/38)23.7% (9/38)10.5% (4/38)13.2% (5/38)5.3% (2/38)5.3% (2/38)7.9% (3/38)13.2% (5/38)0.0% (0/38)0.0% (0/38)
LSO454.4% (2/45)11.1% (5/45)24.4% (11/45)13.3% (6/45)15.6% (7/45)4.4% (2/45)0.0% (0/45)11.1% (5/45)4.4% (2/45)0.0% (0/45)
WP3517.1% (6/35)5.7% (2/35)28.6% (10/35)2.9% (1/35)2.9% (1/35)8.6% (3/35)5.7% (2/35)5.7% (2/35)0.0% (0/35)0.0% (0/35)
U30.0%
(0/3)		0.0%
(0/3)		0.0%
(0/3)		0.0%
(0/3)		0.0%
(0/3)		0.0%
(0/3)		0.0%
(0/3)		0.0%
(0/3)		0.0%
(0/3)		0.0%
(0/3)
Total2309.6% (22/230)13.0% (30/230)22.2% (51/230)7.8% (18/230)8.7% (20/230)6.1% (14/230)3.5% (8/230)8.3% (19/230)2.6% (6/230)0.9% (2/230)
a The citrus cultivars collected in this study were Eureka lemon (EL, Citrus limon), Tankan tangor (TK, C. tankan), Ponkan mandarin (PK, C. reticulata), Murcott tangor (Mur, C. reticulate × C. sinensis), Liucheng sweet orange (LSO, C. sinensis), and Wentan pomelo (WP, C. grandis), as well as unknown (U) cultivars.
Table
Table 4. Detection of Candidatus Liberibacter asiaticus (CLas), citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and citrus exocortis viroid (CEVd) in citrus seedlings using multiplex RT-PCR.
Table 4. Detection of Candidatus Liberibacter asiaticus (CLas), citrus tristeza virus (CTV), citrus tatter leaf virus (CTLV), and citrus exocortis viroid (CEVd) in citrus seedlings using multiplex RT-PCR.
Cultivar aNo. of SamplesNo. of Positive Detection
CLas
Only		CTV
Only		CTLV OnlyCEVd OnlyCLas
+
CTV		CLas
+
CTLV		CLas
+
CEVd		CTV
+
CTLV
Seedling orchard 1PK2025301001
WP2030310110
Seedling orchard 2PK2001100000
WP2010000000
Seedling orchard 3EL2027000001
Total100813711112
a The citrus cultivars collected were Ponkan mandarin (PK, Citrus reticulata), Wentan pomelo (WP, C. grandis), and Eureka lemon (EL, C. limon).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yao, S.-M.; Wu, M.-L.; Hung, T.-H. Development of Multiplex RT-PCR Assay for the Simultaneous Detection of Four Systemic Diseases Infecting Citrus. Agriculture 2023, 13, 1227. https://doi.org/10.3390/agriculture13061227

AMA Style

Yao S-M, Wu M-L, Hung T-H. Development of Multiplex RT-PCR Assay for the Simultaneous Detection of Four Systemic Diseases Infecting Citrus. Agriculture. 2023; 13(6):1227. https://doi.org/10.3390/agriculture13061227

Chicago/Turabian Style

Yao, Shun-Min, Meng-Ling Wu, and Ting-Hsuan Hung. 2023. "Development of Multiplex RT-PCR Assay for the Simultaneous Detection of Four Systemic Diseases Infecting Citrus" Agriculture 13, no. 6: 1227. https://doi.org/10.3390/agriculture13061227

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop