Next Article in Journal
Photosynthetic and Physiological Responses to Combined Drought and Low–Temperature Stress in Poa annua Seedlings from Different Provenances
Next Article in Special Issue
Dried Date (Phoenix dactylifera L.) Meal Inclusion in the Diets of Broilers Affects Growth Performance, Carcass Traits, Nutrients Digestibility, Fecal Microbiota and Economics
Previous Article in Journal
Hyperspectral Estimation of SPAD Value of Cotton Leaves under Verticillium Wilt Stress Based on GWO–ELM
Previous Article in Special Issue
Assessment of the Chemical Composition and Nutritional Quality of Breast Muscle from Broiler Chickens Receiving Various Levels of Fe Glycine Chelate
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 13
Issue 9
10.3390/agriculture13091780
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Dietary Galla Chinensis Tannin Supplementation on Antioxidant Capacity and Intestinal Microbiota Composition in Broilers

by
Peng Yuan
1,
Xiaojie Ren
2,
Jiaxing Niu
1,
Yang Liu
1,
Libo Huang
1,
Shuzhen Jiang
1,
Ning Jiao
1,
Xuejun Yuan
3,
Weiren Yang
1 and
Yang Li
1,*
1
Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Key Laboratory of Efficient Utilization of Non-Grain Feed Resources, Ministry of Agriculture and Rural Affairs, Department of Animal Science and Veterinary Medicine, Shandong Agricultural University, Daizong Street 61#, Tai’an 271018, China
2
Shandong Taishan Shengliyuan Group Co., Ltd., Tai’an 271000, China
3
College of Life Sciences, Shandong Agricultural University, Daizong Street 61#, Tai’an 271018, China
*
Author to whom correspondence should be addressed.
Agriculture 2023, 13(9), 1780; https://doi.org/10.3390/agriculture13091780
Submission received: 2 August 2023 / Revised: 30 August 2023 / Accepted: 6 September 2023 / Published: 8 September 2023
(This article belongs to the Special Issue Effects of Dietary Interventions on Poultry Production)
Browse Figures
Review Reports Versions Notes

Abstract

:
The current study aimed to investigate the effects of dietary Galla Chinensis tannin (GCT) supplementation on antioxidant capacity and gut microbiota composition in broilers. Two hundred eighty-eight Arbor Acres broiler chicks were divided into the CON group and the GCT group; each treatment group contained 6 replicates with 24 broiler chicks per replicate for a period of 42 days, and were fed either a basal diet or the basal diet supplemented with 300 mg/kg GCT. Results revealed that GCT supplementation significantly increased glutathione peroxidase (GSH-Px) activity (p < 0.05) and significantly decreased malondialdehyde (MAD) concentrations in serum (p < 0.05) and significantly increased GSH-Px and catalase (CAT) (p < 0.05) and significantly decreased MDA concentrations in the small intestine. In addition, GCT significantly up-regulated (p < 0.05) the gene expressions of nuclear factor erythroid 2-related factor 2 (Nrf2), heme-oxygenase 1 (HO-1), catalase (CAT), glutathione peroxidase-1 (GPX1), and NAD(P)H quinone oxidoreductase 1(NQO1). High-throughput sequencing results showed that GCT supplementation significantly increased abundances of Faecalibacterium and Megamonas (p < 0.05). These findings will contribute to our understanding of the effects of dietary Galla Chinensis tannin supplementation on antioxidant capacity and intestinal microbiota composition in broilers.

1. Introduction

Broilers are stimulated by stress factors such as transportation, immunization, high stocking density, disease and environment, resulting in an increase in reactive oxygen species (ROS), which eventually leads to oxidative stress [1]. However, the gut is highly vulnerable to oxidative stress due to the abundance of mitochondria in gut cells, which are the main sites of ROS generation [2,3]. In the process of antioxidative stress, nuclear factor erythroid 2-related factor 2(Nrf2), as a central regulator to maintain the balance of oxidation reduction in cells, can induce the expression of a series of antioxidant genes such as superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase-1 (GPX1), NAD(P)H quinone oxidoreductase 1(NQO1) and heme-oxygenase 1(HO-1), regulating the secretion of antioxidant enzymes and reducing the damage caused by oxidative stress to cells [4,5]. On the other hand, the intestinal microbiota is composed of a large number of bacterial species and plays a crucial role in regulating intestinal mucosal nutrient absorption and constructing immune barriers [6,7]. Previous studies have shown that oxidative stress can lead to apoptosis, impair gut development, and disturb the gut microbiota, thereby affecting the development and health of broilers [8,9,10]. Therefore, it is critical to reduce oxidative stress and maintain the stability of the microbiota in the broiler gut.
Galla Chinensis is commonly used as a Chinese herbal medicine in the animal husbandry industry. Galla Chinensis tannin (GCT) is a hydrolytic tannin, which is the main pharmacologically active component of gallnut [11]. Studies have shown that tannins have various biological functions such as antibacterial, anti-inflammatory, and anti-oxidative activities and regulation of cell apoptosis [12]. Moreover, it has also been proved that tannin has positive effects on poultry gut development [13,14]. However, tannin was once considered as an antinutritional factor in monogastric animals [15,16]. This is because tannins can precipitate nutrients such as proteins, carbohydrates, digestive enzymes and metal ions, resulting in reduced absorption by animals [17,18]. In a recent study, it was found that supplementation with low doses of tannin could promote the development of the liver and intestines of animals, improving the production performance of broilers [19,20]. Moreover, Jing C and Niu J et al. [21,22] found that dietary supplementation of 300 mg/kg GCT can also promote broiler growth and have positive effects on liver health and intestinal development.
However, there is still little published information on whether GCT can improve the intestinal microbiota and antioxidant capacity of broilers. Therefore, this study examined the effects of dietary supplementation of 300 mg/kg GCT on antioxidant capacity and intestinal microbiota in broilers, so as to provide a reference for the use of GCT in the poultry industry.

2. Materials and Methods

2.1. Experimental Design and Management

Two hundred eighty-eight 1-day-old male Arbor Acres broiler chicks (body weight: 48.25 ± 0.35 g) were randomly divided into two dietary treatment groups, and each treatment group contained 6 replicates with 24 broiler chicks per replicate for a period of 42 days. From the first day of the experimental period, the two treatment groups were fed different diets as follows: (1) Broilers fed basal diet as Control (CON) group; (2) Broilers fed basal diet supplemented with 300 mg/kg GCT as GCT group; the GCT was added to the basal diets at the expense of corn. Extract of GCT was provided by Wufeng Chicheng Biotechnology Co., Ltd. (Yichang, China). The production technology of microencapsulation was provided by Hangzhou Kangjude Co., Ltd., Hangzhou, China, and the final effective concentration contained a 40% effective concentration of GCT. According to the feeding requirements of the Chinese Ministry of Agriculture (2004) [23], a two-stage feeding program (0–21 days and 21–42 days) was configured (Table 1). The broilers were provided with adequate fresh water and feed throughout the period of 42 days and managed according to Broiler Management Guideline (Acres, 2009) [24]. Broilers were kept in wire cages (400 cm2/broiler) in a controlled environment with continuous light. The coop was kept lit 18 h a day. The temperature of the coop was controlled at 32–35 °C for the first 8 days, then decreased by 1 °C every 2 days and eventually kept at 26 °C. In addition, all broilers were vaccinated according to the routine immunization schedule; Newcastle disease vaccine was administered on day 7 of the trial, and an inactivated vaccine against the infectious bursal virus was administered on day 14.
The Animal Protection and Utilization Committee of Shandong Agricultural University approved and supervised the plan and process of this experiment (SDAUA-2021-019).

2.2. Sample Collection

After fasting for 12 h after the 42 day experimental period, a broiler was randomly selected for each repetition (a total of 6 broilers). Blood samples (5 mL) were collected from the wing vein with a vacuum blood collection tube, placed in a centrifuge (3500 rpm, 4 °C, 15 min), and the serum was obtained and stored at −20 °C until analysis. After each bird was euthanized by carbon dioxide asphyxiation, the intestine was quickly taken out to remove the intestinal chyme. The mucosal tissue of the same part of the small intestine was scraped off with microslides, which were rapidly frozen in liquid nitrogen and stored at −80 °C until analysis. At the same time, the contents of the cecum were collected and stored in sterile stool collection tubes at −80 °C for further analysis.

2.3. Antioxidative Parameters and Endotoxin Concentration

The detection of oxidation and anti-oxidation parameters glutathione peroxidase (GSH-Px), total superoxide dismutase (T-SOD), catalase (CAT), malondialdehyde (MDA), and endotoxin (ET) in serum and intestinal mucosa was carried out with a special detection kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The detection method was conducted according to the protocol of the previous study [25].

2.4. SCFA Concentrations and pH Values

Short-chain fatty acids (SCFAs) in cecal digesta of broilers were determined according to a method based on a previous study [26]. Briefly, 0.7 g of cecal digesta sample was put into 1.5 mL of distilled water and stirred evenly. After standing still (30 min), it was placed in a centrifuge (12,000 rpm, 4 °C, 15 min). One milliliter of the supernatant was taken and mixed with 0.2 mL of metaphosphoric acid (25%, w/v) and 23.3 μL glutamic acid (210 mmol/L), stirred well, allowed to stand for 10 min, and then centrifuged (12,000 rpm, 4 °C, 10 min). The supernatant was then mixed with an equal amount of methanol. It was then analyzed by gas chromatography (Varian CP-3800 GC Varian Corporation, Palo Alto, CA, USA). The pH value of cecal digesta was measured using a pH meter as previously described [27].

2.5. Analysis of Gene Expression

Intestinal tissue samples of 50–100 mg were taken and ground in a mortar containing liquid nitrogen until powdered. Total RNA was extracted using TRIzol reagent (Accurate Biology, Dalian, China), and then reverse transcribed into cDNA using complementary DNA Synthesis Kit (Accurate Biology, Dalian, China). The LightCycler 96 (Roch, Switzerland) fluorescent quantitative PCR instrument was used for quantification. The real-time PCR reaction system was prepared according to the instructions of the qPCR kit (Accurate Biology, Dalian, China), using β-actin as an internal reference, and related gene primer sequences (Table 2), as previously described [13]. The relative expression of genes was calculated according to the 2−ΔΔCT method.

2.6. Microbial Analysis of Cecal Digesta

The genomic DNA of cecal digesta was extracted by the fecal DNA Kit (Omega, Norcross, GA, USA). The concentration and purity of genomic DNA were assessed by agarose gel electrophoresis [25]. PCR amplification of the V4 hypervariable region of 16S rDNA was performed with primers (Table 2). Genomic DNA sequencing and data analysis were performed on the Illumina HiSeq Sequencer (platform type: PE250; Beijing Novogene Bioinformation Technology Co., Ltd., Beijing, China). The end sequences were merged using FLASH (v1.2.7) [28], and compared with the Silva database using the UCHIME algorithm, removing the chimeric sequences. The effective sequences were obtained by quality filtering the original tags [29]. Sequences were clustered using Uparse software (usearch10.0.240_win32), obtaining clustering sequences with at least 97% similarity to the same taxonomic unit (OTUs) [30]. Taxonomic information was annotated using the Silva Database [31]. Four indices (Shannon, ACE, Simpson, Chao1) and observed species were used to confirm the alpha diversity of different diet groups. All sequencing data are available in the NCBI Sequence Read Archive (SRA) under accession PRJNA941051 (Illumina sequences).

2.7. Statistical Analysis

Effects of all variables were considered based on individual bird data as the experimental unit. Except for microbial data analysis, all data indicators were evaluated for significance using the t-test program of SAS 9.0 (Institute Inc., Cary, NC, USA). Non-normally distributed data were transformed to achieve normal distribution. A histogram was drawn using GraphPad Prism 8.0 (GraphPad Software, Inc., La Jolla, CA, USA). The dissimilarity matrices of OTUs were calculated and visualized using principal coordinate analysis (PCoA). Similarity analysis (ANOSIM) was used to analyze the differences between different microbial communities. The values in tables and graphs are expressed as mean ± standard error. A p-value < 0.05 was considered statistically significant; 0.05 ≤ p-values < 0.10 was considered to indicate a significant trend.

3. Results

3.1. Antioxidant Status and Endotoxin Concentration in Serum

As shown in Figure 1, the GCT group had notably increased (p < 0.05) concentrations of GSH-Px (Figure 1A) in serum, while T-SOD (Figure 1B) and CAT (Figure 1C) concentrations were not extraordinarily different (p > 0.05). The concentrations of MDA (Figure 1D) and ET (Figure 1E) in the GCT group were significantly lower (p < 0.05).

3.2. Antioxidant Status in Intestinal Mucosa

Figure 2 shows that MDA (Figure 2D) concentrations in the intestine were dramatically lower (p < 0.001) in the GCT group, while CAT (Figure 2C) activity was significantly higher (p < 0.05); GCT also increased the activity of GSH-Px (Figure 2A) in intestinal mucosa. However, the activity of T-SOD (Figure 2B) in the GCT group was not noticeably increased (p > 0.05).

3.3. Expression of Antioxidant-Related Genes

Figure 3 presents the expression levels of antioxidant-related genes Nrf2 (Figure 3B), HO-1 (Figure 3C), and CAT (Figure 3D), which in the GCT group were significantly higher than those in the CON group (p < 0.01). The average expression levels of Nrf2, HO-1 and CAT in the GCT group were 1.78 times, 1.5 times and 1.44 times higher, respectively, compared with those in the control group. Moreover, the gene expression levels of GPX1 (Figure 3G) and NQO1 (Figure 3H) increased significantly (p < 0.05). Compared with the control group, the average expression levels of GPX1 and NQO1 in the GCT group were 1.35 times and 1.40 times higher, respectively. Moreover, GCT supplementation tended to increase the gene expression levels of Sirt1 (Figure 3A). There were no significant differences (p > 0.10) in mRNA expression of SOD1 (Figure 3E) and SOD2 (Figure 3F) in intestinal mucosa between the two groups.

3.4. SCFA Concentrations and pH Values of Cecal Contents

The pH value of cecal digesta in the GCT group was significantly lower (p < 0.05) (Figure 4A). In addition, the concentration of butyrate in the GCT group was significantly higher (p < 0.05) (Figure 4D), and the concentration of total SCFAs also tended to increase (Figure 4E). No extraordinary differences (p > 0.05) in the concentrations of acetate and propionate were observed between the GCT group and CON group (Figure 4B,C).

3.5. Microbial Diversity in Cecal Digesta

The relative abundance (top 10) of the cecal microbiota at the phylum level is shown in Figure 5 and Table 3. In the CON group, the first abundant phylum was identified as Bacteroidetes, accounting for 32.23%, and the second most abundant phylum was Firmicutes, accounting for 32.19%, while in the GCT group, the most abundant phylum was Firmicutes (35.36%), and the second most abundant phylum was Bacteroidetes (32.93%). The results for the phylum level of relative abundance (top 10) did not change significantly between the two treatment groups (p > 0.05).
The relative abundance of cecal microbiota (top 20) at the genus level is shown in Figure 6 and Table 4. The relative abundance of Faecalibacterium and Megamonas in GCT group broilers was significantly increased (p < 0.05). However, no difference (p > 0.05) was observed in relative abundance (top 20) at the genus level.

3.6. Microbial Richness and Diversity in Cecal Digesta

PCoA analysis showed that there was no significant dispersion between the GCT group and the CON group, indicating that the bacterial community structure was similar between the two treatment groups (Figure 7).
The observed-species (Figure 8A), Chao 1 (Figure 8D), and ACE indexes (Figure 8E) in the GCT group were noticeably lower (p < 0.05) than those in the CON group. However, the Shannon (Figure 8B) and Simpson (Figure 8C) indices showed similar levels between the two dietary groups.
ANOSIM analysis results are shown in Table 5. There were no significant differences in microbial community structure between the CON group and GCT group (p > 0.05).

4. Discussion

The potential of tannins as antioxidants has been demonstrated in in vivo and in vitro experiments [32,33,34]. The antioxidant status of cattle and sheep can be effectively improved by adding tannin-containing feed [35,36]. However, the mechanism of how tannins play an antioxidant role in animal tissues needs further study. It has been shown that enzyme and non-enzyme systems play a key role in protecting animals from oxidative damage [37]. Endogenous antioxidant enzymes GSH-Px, CAT and SOD play a vital role in defending against oxidative stress. ROS is converted to hydrogen peroxide (H2O2) by SOD, followed by degradation of H2O2 to water and oxygen by CAT and GSH-Px [38,39]. MDA is a non-enzymatic indicator closely related to cell oxidative damage that can reflect the degree of free radical damage to body cells [40]. However, MDA is a secondary product of lipid oxidation and is closely related to cell damage, so MDA is widely considered as an indicator to monitor the degree of lipid peroxidation [41]. In conclusion, 300 mg/kg of dietary GCT supplementation can increase the activity of GSH-Px in serum and intestinal mucosa; in addition, the level of MDA was significantly reduced. Ultimately, it improves the intestinal antioxidant capacity of broilers.
In order to further determine the potential mechanism of dietary supplementation of 300 mg/kg GCT to improve antioxidant ability, the expression levels of Nrf2/HO-1 pathway-related genes in intestinal mucosa were quantified. Previous studies have demonstrated that the Nrf2/HO-1 pathway plays a key role in the defense against oxidative stress [42]. Nrf2 is the most important transcription factor in eukaryotic cells, regulating the expression of a series of enzymes with important antioxidant and detoxification functions [43]. Many studies have shown that Nrf2 is activated as a promoter after oxidative stress occurs, and then the expression of the downstream target HO-1 is activated. As an important antioxidant enzyme, HO-1 can regulate intracellular ROS levels to relieve cellular oxidative stress response [42]. In the current study, dietary GCT supplementation significantly up-regulated the expression levels of Nrf2 and HO-1 in the intestinal mucosa. Therefore, these results indicated that GCT might enhance the antioxidant enzyme activity by activating the Nrf2/HO-1 pathway in the small intestine of broilers.
A reduction in microbial diversity can be seen as a negative effect of dietary processing, as the heterogeneity of the gastrointestinal microbiota and its robustness are associated with the ability to support gut health [44,45]. Interestingly, we found that there were no significant differences in the Shannon and Simpson indices between the CON and GCT groups. However, the addition of 300 mg/kg GCT in the diet reduced the observed-species, Chao1, and ACE indices of broiler cecal microbiota, which are important indicators of alpha diversity for calculating unique OTUs and estimating community richness, respectively [25,27]. Consistent with our findings, Van Hul et al. [46] reported that tannin supplementation significantly reduced the alpha diversity of cecal microbiota. The decreased bacterial richness might be related to the bacteriostatic activity of tannins [47,48]. In addition, the effect of tannin on the intestinal microbiota was related to the dose and type of use [14]. In a previous study on the effects of microcapsules containing three doses of TA (500 mg/kg; 1000 mg/kg; 1500 mg/kg), respectively administered to three groups of weaned piglets, only the 1000 mg/kg GCT group showed positive regulatory effects on the intestinal microbiota [49]. Brugaletta et al. [50] studied two different types of tannin supplements, A and C, added at 0.12–0.13% to broiler diets, and found that the cecal microbial diversity of the broilers in the tannin supplement C group was significantly reduced. At present, there are few studies on the effects of GCT on the intestinal microbiota of broilers, and our study only reflected the effects of 300 mg/kg GCT on the intestinal microbiota of broilers, which may be related to the dose of GCT. Microcapsules can improve the palatability of tannins, alleviate the impact on the gastrointestinal tract, and change the main absorption site [51]. Therefore, microencapsulation technology, solvents and coating agents also have important effects on the intestinal microbiota of animals.
Beneficial bacteria are involved in a variety of biological functions in the body, including producing digestive enzymes, increasing leukocyte activity, and providing essential vitamins and amino acids [52]. Alterations in the composition of the gut microbiota are also associated with oxidative stress [20]. We found that 300 mg/kg of dietary GCT supplementation increased the abundance of Firmicutes, surpassing Bacteroidetes as the most abundant phylum. Bacteroidetes and Firmicutes are the two main phyla of intestinal microbes in animals and humans [53,54]. Firmicutes microbes mainly produce butyrate, which can provide high butyrate levels to young chickens to supply fast-growing intestinal cells [55]. SCFAs produced by Firmicutes and Bacteroides may be regulated by changes in pH, favoring Firmicutes at lower pH and favoring Bacteroidetes at a more neutral pH [56]. In the present study, dietary supplementation with GCT increased the abundance of dominant Faecalibacterium and Megamonas in the cecal digesta of broilers at the genus level. Faecalibacterium is the main producer of butyrate in the gut, which exerts anti-inflammatory functions by maintaining lysozyme activity and preventing pathogen invasion [57]. Megamonas facilitates the fermentation of various carbohydrates in the gut [58]. In addition, Megamonas, the main propionic acid-producing bacteria in Firmicutes, can promote ammonia production by expressing alanine dehydrogenase, which may affect the metabolism of host epithelial cells and other members of the flora [59]. Consistently, the concentration of total SCFAs was higher in the GCT group compared with the control group, among which the concentration of butyrate was significantly higher than that in the control group. SCFAs produced by gut microbiota or agonists of specific G protein-coupled receptor GPR43 have been reported to inhibit oxidative stress [60]. This may be another reason to improve intestinal antioxidant capacity.

5. Conclusions

In summary, 300 mg/kg of dietary GCT supplementation had a positive effect on the antioxidant capacity of broilers. The mechanism may be related to enhancing the antioxidant capacity by activating the Nrf2/HO-1 signaling pathway and changing the intestinal microbiota composition of broilers. The results of this study will help to understand the effects of dietary GCT on the regulation of antioxidant capacity and intestinal microbiota in broilers and provide a reference for the application of GCT in the poultry industry.

Author Contributions

Conceptualization, P.Y., W.Y. and Y.L. (Yang Li); methodology, P.Y., X.R., J.N. and Y.L. (Yang Liu); software, W.Y., X.R., L.H. and Y.L. (Yang Li); validation, L.H. and Y.L. (Yang Li); formal analysis, P.Y., X.R. and L.H.; investigation, N.J., S.J. and X.Y.; resources, N.J., S.J. and X.Y.; data curation, P.Y., J.N. and X.R.; writing—original draft preparation, P.Y.; writing—review and editing, Y.L. (Yang Li); visualization, L.H. and Y.L. (Yang Li); supervision, L.H. and Y.L. (Yang Li); project administration, P.Y., X.R. and Y.L. (Yang Liu); funding acquisition, W.Y. All authors have read and agreed to the published version of the manuscript.

Funding

Science and technology innovation project of medium, small and micro enterprises in Shandong Province (2022TSGC12).

Institutional Review Board Statement

The Animal Protection and Utilization Committee of Shandong Agricultural University approved and supervised the plan and process of this experimental study (SDAUA-2021-019).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Panda, A.K.; Cherian, G. Role of vitamin E in counteracting oxidative stress in poultry. J. Poult. Sci. 2014, 51, 109–117. [Google Scholar] [CrossRef]
  2. Liu, Y.; Bao, Z.; Xu, X.; Chao, H.; Lin, C.; Li, Z.; Liu, Y.; Wang, X.; You, Y.; Liu, N. Extracellular signal-regulated kinase/nuclear factor-erythroid2-like2/heme oxygenase-1 pathway-mediated mitophagy alleviates traumatic brain injury-induced intestinal mucosa damage and epithelial barrier dysfunction. J. Neurotraum. 2017, 34, 2119–21314. [Google Scholar] [CrossRef] [PubMed]
  3. Figueira, T.R.; Barros, M.H.; Camargo, A.A.; Castilho, R.F.; Ferreira, J.C.; Kowaltowski, A.J.; Sluse, F.E.; Souza-Pinto, N.C.; Vercesi, A.E. Mitochondria as a source of reactive oxygen and nitrogen species: From molecular mechanisms to human health. Antioxid. Redox Signal. 2013, 18, 2029–2074. [Google Scholar] [CrossRef] [PubMed]
  4. Li, M.; Huang, W.; Jie, F.; Wang, M.; Zhong, Y.; Chen, Q.; Lu, B. Discovery of Keap1−Nrf2 small−molecule inhibitors from phytochemicals based on molecular docking. Food Chem. Toxicol. 2019, 133, 110758. [Google Scholar] [CrossRef] [PubMed]
  5. Zhao, L.; Yang, H.; Xu, M.; Wang, X.; Wang, C.; Lian, Y.; Mehmood, A.; Dai, H. Stevia residue extract ameliorates oxidative stress in d-galactose-induced aging mice via Akt/Nrf2/HO-1 pathway. J. Funct. Foods. 2019, 52, 587–595. [Google Scholar] [CrossRef]
  6. Camara-Lemarroy, C.R.; Metz, L.M.; Yong, V.W. Focus on the gutbrain axis: Multiple sclerosis, the intestinal barrier and the microbiome. World J. Gastroenterol. 2018, 24, 4217–4223. [Google Scholar] [CrossRef]
  7. Zhang, S.; Shen, Y.R.; Wu, S.; Xiao, Y.Q.; He, Q.; Shi, S.R. The dietary combination of essential oils and organic acids reduces Salmonella enteritidis in challenged chicks. Poult. Sci. 2019, 98, 6349–6355. [Google Scholar] [CrossRef]
  8. Li, Y.; Zhao, X.; Jiang, X.; Chen, L.; Hong, L.; Zhuo, Y.; Lin, Y.; Fang, Z.; Che, L.; Feng, B. Effects of dietary supplementation with exogenous catalase on growth performance, oxidative stress, and hepatic apoptosis in weaned piglets challenged with lipopolysaccharide. J. Anim. Sci. 2020, 98, skaa067. [Google Scholar] [CrossRef]
  9. Degroote, J.; Vergauwen, H.; Van Noten, N.; Wang, W.; De Smet, S.; Van Ginneken, C.; Michiels, J. The effect of dietary quercetin on the glutathione redox system and small intestinal functionality of weaned piglets. Antioxidants 2019, 8, 312. [Google Scholar] [CrossRef]
  10. Hu, C.; Xiao, K.; Luan, Z.; Song, J. Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs. J. Anim. Sci. 2013, 91, 1094–1101. [Google Scholar] [CrossRef]
  11. Ren, Y.Y.; Zhang, X.R.; Li, T.N.; Zeng, Y.J.; Wang, J.; Huang, Q.W. Galla chinensis, a traditional Chinese medicine: Comprehensive review of botany, traditional uses, chemical composition, pharmacology and toxicology. J. Ethnopharmacol. 2021, 278, 114247. [Google Scholar] [CrossRef] [PubMed]
  12. Guo, Z.; Xie, W.; Lu, J.; Guo, X.; Xu, J.; Xu, W.; Chi, Y.; Takuya, N.; Wu, H.; Zhao, L. Tannic acid-based metal phenolic networks for bio-applications: A review. J. Mater. Chem. B 2021, 9, 4098–4110. [Google Scholar] [CrossRef]
  13. Liu, Y.; Li, Y.; Niu, J.; Liu, H.; Jiao, N.; Huang, L.; Jiang, S.; Yan, L.; Yang, W. Effects of dietary macleaya cordata extract containing isoquinoline alkaloids supplementation as an alternative to antibiotics in the diets on growth performance and liver health of broiler chickens. Front. Vet. Sci. 2022, 9, 950174. [Google Scholar] [CrossRef] [PubMed]
  14. Huang, Q.; Liu, X.; Zhao, G.; Hu, T.; Wang, Y. Potential and challenges of tannins as an alternative to in-feed antibiotics for farm animal production. Anim. Nutr. 2018, 4, 137–150. [Google Scholar] [CrossRef]
  15. Lavin, S.R.; Chen, Z.; Abrams, S.A. Effect of tannic acid on iron absorption in straw-colored fruit bats (Eidolon helvum). Zoo Biol. 2010, 29, 335–343. [Google Scholar] [CrossRef]
  16. Jansman, A. Tannins in feedstuffs for simple-stomached animals. Nutr. Res. Rev. 1993, 6, 209–236. [Google Scholar] [CrossRef] [PubMed]
  17. Chung, K.-T.; Wong, T.Y.; Wei, C.-I.; Huang, Y.-W.; Lin, Y. Tannins and human health: A review. Crit. Rev. Food. Sci. 1998, 38, 421–464. [Google Scholar] [CrossRef]
  18. Lee, S.; Shinde, P.; Choi, J.; Kwon, I.; Lee, J.; Pak, S.; Cho, W.; Chae, B. Effects of tannic acid supplementation on growth performance, blood hematology, iron status and faecal microflora in weanling pigs. Livest. Sci. 2010, 131, 281–286. [Google Scholar] [CrossRef]
  19. Starčević, K.; Krstulović, L.; Brozić, D.; Maurić, M.; Stojević, Z.; Mikulec, Ž.; Bajić, M.; Mašek, T. Production performance, meat composition and oxidative susceptibility in broiler chicken fed with different phenolic compounds. J. Sci. Food Agric. 2015, 95, 1172–1178. [Google Scholar] [CrossRef]
  20. Song, Y.; Luo, Y.; Yu, B.; He, J.; Zheng, P.; Mao, X.; Huang, Z.; Luo, J.; Luo, Y.; Yan, H. Tannic acid extracted from gallnut prevents post-weaning diarrhea and improves intestinal health of weaned piglets. Anim. Nutr. 2021, 7, 1078–1086. [Google Scholar] [CrossRef]
  21. Jing, C.; Niu, J.; Liu, Y.; Jiao, N.; Huang, L.; Jiang, S.; Yan, L.; Yang, W.; Li, Y. Tannic acid extracted from galla chinensis supplementation in the diet improves intestinal development through suppressing inflammatory responses via blockage of NF-κB in broiler chickens. Animals 2022, 12, 2397. [Google Scholar] [CrossRef]
  22. Niu, J.; Wang, Q.; Jing, C.; Liu, Y.; Liu, H.; Jiao, N.; Huang, L.; Jiang, S.; Guan, Q.; Li, Y. Dietary galla chinensis tannic acid supplementation in the diets improves growth performance, immune function and liver health status of broiler chicken. Front. Vet. Sci. 2022, 9, 1024430. [Google Scholar] [CrossRef]
  23. NY/T 33–2004; Feeding Standard of Chicken, China. Ministry of Agriculture: Beijing, China, 2004.
  24. Acres, A. Broiler Management Guide; Aviagen Limited: Midlothian, UK, 2009; pp. 1–59. [Google Scholar]
  25. Chen, J.; Li, F.; Yang, W.; Jiang, S.; Li, Y. Supplementation with exogenous catalase from penicillium notatum in the diet ameliorates lipopolysaccharide-induced intestinal oxidative damage through affecting intestinal antioxidant capacity and microbiota in weaned pigs. Microbiol. Spectr. 2021, 9, e00654-21. [Google Scholar] [CrossRef]
  26. Li, Y.; Liu, H.; Zhang, L.; Yang, Y.; Lin, Y.; Zhuo, Y.; Fang, Z.; Che, L.; Feng, B.; Xu, S. Maternal dietary fiber composition during gestation induces changes in offspring antioxidative capacity, inflammatory response, and gut microbiota in a sow model. Int. J. Mol. Sci. 2019, 21, 31. [Google Scholar] [CrossRef] [PubMed]
  27. Li, Y.; Zhao, X.; Zhang, L.; Zhan, X.; Liu, Z.; Zhuo, Y.; Lin, Y.; Fang, Z.; Che, L.; Feng, B. Effects of a diet supplemented with exogenous catalase from penicillium notatum on intestinal development and microbiota in weaned piglets. Microorganisms 2020, 8, 391. [Google Scholar] [CrossRef] [PubMed]
  28. Magoč, T.; Salzberg, S.L. Flash: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef]
  29. Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. Uchime improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef] [PubMed]
  30. Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef]
  31. Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The silva ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2012, 41, D590–D596. [Google Scholar] [CrossRef]
  32. Barreira, J.C.; Ferreira, I.C.; Oliveira, M.B.P.; Pereira, J.A. Antioxidant activities of the extracts from chestnut flower, leaf, skins and fruit. Food Chem. 2008, 107, 1106–1113. [Google Scholar] [CrossRef]
  33. Beninger, C.W.; Hosfield, G.L. Antioxidant activity of extracts, condensed tannin fractions, and pure flavonoids from Phaseolus vulgaris L. seed coat color genotypes. J. Agric. Food Chem. 2003, 51, 7879–7883. [Google Scholar] [CrossRef] [PubMed]
  34. Dutta, N.; Dubey, M.; Banerjee, P.S.; Pattanaik, A.K.; Sharma, K.; Kumar, P.; Narang, A. Effect of supplementing tanniferous tree leaves mixture on immune response and GI nematodes in kids. Livest. Res. Rural Dev. 2012, 24. Available online: http://www.lrrd.org/lrrd24/2/dutt24035.htm (accessed on 2 August 2023).
  35. Dey, A.; De, P.S. Influence of condensed tannins from Ficus bengalensis leaves on feed utilization, milk production and antioxidant status of crossbred cows. Asian Australas. J. Anim. Sci. 2014, 27, 342. [Google Scholar] [CrossRef]
  36. Peng, K.; Shirley, D.C.; Xu, Z.; Huang, Q.; McAllister, T.A.; Chaves, A.V.; Acharya, S.; Liu, C.; Wang, S.; Wang, Y. Effect of purple prairie clover (Dalea purpurea Vent.) hay and its condensed tannins on growth performance, wool growth, nutrient digestibility, blood metabolites and ruminal fermentation in lambs fed total mixed rations. Anim. Feed Sci. Technol. 2016, 222, 100–110. [Google Scholar] [CrossRef]
  37. Minelli, A.; Bellezza, I.; Conte, C.; Culig, Z. Oxidative stress-related aging: A role for prostate cancer? Bba-Rev. Cancer 2009, 1795, 83–91. [Google Scholar] [CrossRef]
  38. David, M.; Munaswamy, V.; Halappa, R.; Marigoudar, S.R. Impact of sodium cyanide on catalase activity in the freshwater exotic carp, Cyprinus carpio (linnaeus). Pestic. Biochem. Phys. 2008, 92, 15–18. [Google Scholar] [CrossRef]
  39. Finkel, T.; Holbrook, N.J. Oxidants, oxidative stress and the biology of ageing. Nature 2000, 408, 239–247. [Google Scholar] [CrossRef]
  40. Wu, B.; Cui, H.; Peng, X.; Fang, J.; Zuo, Z.; Deng, J.; Huang, J. Dietary nickel chloride induces oxidative intestinal damage in broilers. Int. J. Environ. Res. Public Health 2013, 10, 2109–2119. [Google Scholar] [CrossRef]
  41. Li, H.; Song, F.; Duan, L.-R.; Sheng, J.J.; Xie, Y.H.; Yang, Q.; Chen, Y.; Dong, Q.Q.; Zhang, B.L.; Wang, S.W. Paeonol and danshensu combination attenuates apoptosis in myocardial infarcted rats by inhibiting oxidative stress: Roles of Nrf2/HO-1 and PI3k/AKT pathway. Sci. Rep. 2016, 6, 23693. [Google Scholar] [CrossRef]
  42. Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar] [CrossRef]
  43. Sajadimajd, S.; Khazaei, M. Oxidative stress and cancer: The role of nrf2. Curr. Cancer Drug Targets 2018, 18, 538–557. [Google Scholar] [CrossRef] [PubMed]
  44. Yeoman, C.J.; White, B.A. Gastrointestinal tract microbiota and probiotics in production animals. Annu. Rev. Anim. Biosci. 2014, 2, 469–486. [Google Scholar] [CrossRef]
  45. Van de Guchte, M.; Blottière, H.M.; Doré, J. Humans as holobionts: Implications for prevention and therapy. Microbiome 2018, 6, 1–6. [Google Scholar] [CrossRef] [PubMed]
  46. Van Hul, M.; Geurts, L.; Plovier, H.; Druart, C.; Everard, A.; Ståhlman, M.; Rhimi, M.; Chira, K.; Teissedre, P.L.; Delzenne, N.M. Reduced obesity, diabetes, and steatosis upon cinnamon and grape pomace are associated with changes in gut microbiota and markers of gut barrier. Am. J. Physiol.-Endocrinol. Metab. 2018, 314, E334–E352. [Google Scholar] [CrossRef] [PubMed]
  47. Scalbert, A. Antimicrobial properties of tannins. Phytochemistry 1991, 30, 3875–3883. [Google Scholar] [CrossRef]
  48. Liu, X.L.; Hao, Y.Q.; Jin, L.; Xu, Z.J.; McAllister, T.A.; Wang, Y. Anti-Escherichia coli O157: H7 properties of purple prairie clover and sainfoin condensed tannins. Molecules 2013, 18, 2183–2199. [Google Scholar] [CrossRef]
  49. Wang, M.; Huang, H.; Hu, Y.; Huang, J.; Yang, H.; Wang, L.; Chen, S.; Chen, C.; He, S. Effects of dietary microencapsulated tannic acid supplementation on the growth performance, intestinal morphology, and intestinal microbiota in weaning piglets. J. Anim. Sci. 2020, 98, skaa112. [Google Scholar] [CrossRef]
  50. Brugaletta, G.; Luise, D.; De Cesare, A.; Zampiga, M.; Laghi, L.; Trevisi, P.; Manfreda, G.; Sirri, F. Insights into the mode of action of tannin-based feed additives in broiler chickens: Looking for connections with the plasma metabolome and caecal microbiota. Ital. J. Anim. Sci. 2020, 19, 1349–1362. [Google Scholar] [CrossRef]
  51. Azagheswari, B.K.; Padma, S.; Priya, S.P. A review on microcapsules. Glob. J. Pharmacol. 2015, 9, 28–39. [Google Scholar] [CrossRef]
  52. Ma, N.; Guo, P.; Zhang, J.; He, T.; Kim, S.W.; Zhang, G.; Ma, X. Nutrients mediate intestinal bacteria-mucosal immune crosstalk. Front. Immunol. 2018, 9, 5. [Google Scholar] [CrossRef]
  53. Eckburg, P.B.; Bik, E.M.; Bernstein, C.N.; Purdom, E.; Dethlefsen, L.; Sargent, M.S.; Gill, R.; Nelson, K.E.; Relman, D.A. Diversity of the human intestinal microbial flora. Science 2005, 308, 1635–1638. [Google Scholar] [CrossRef] [PubMed]
  54. Jandhyala, S.M.; Talukdar, R.; Subramanyam, C.; Vuyyuru, H.; Sasikala, M.; Nageshwar Reddy, D. Role of the normal gut microbiota. World J. Gastroenterol. 2015, 21, 8787–8803. [Google Scholar] [CrossRef] [PubMed]
  55. Polansky, O.; Sekelova, Z.; Faldynova, M.; Sebkova, A.; Sisak, F.; Rychlik, I. Important metabolic pathways and biological processes expressed by chicken cecal microbiota. Appl. Environ. Microb. 2016, 82, 1569–1576. [Google Scholar] [CrossRef] [PubMed]
  56. Hamer, H.M.; Jonkers, D.; Venema, K.; Vanhoutvin, S.; Troost, F.; Brummer, R.J. The role of butyrate on colonic function. Aliment. Pharm. Ther. 2008, 27, 104–119. [Google Scholar] [CrossRef]
  57. Miquel, S.; Martin, R.; Rossi, O.; Bermúdez-Humarán, L.; Chatel, J.; Sokol, H.; Thomas, M.; Wells, J.; Langella, P. Faecalibacterium prausnitzii and human intestinal health. Curr. Opin. Microbiol. 2013, 16, 255–261. [Google Scholar] [CrossRef]
  58. Chevrot, R.; Carlotti, A.; Sopena, V.; Marchand, P.; Rosenfeld, E. Megamonas rupellensis sp. Nov., an anaerobe isolated from the caecum of a duck. Int. J. Syst. Evol. Microbiol. 2008, 58, 2921–2924. [Google Scholar] [CrossRef]
  59. Davila, A.M.; Blachier, F.; Gotteland, M.; Andriamihaja, M.; Benetti, P.H.; Sanz, Y.; Tomé, D. Re-print of “intestinal luminal nitrogen metabolism: Role of the gut microbiota and consequences for the host”. Pharmacol. Res. 2013, 69, 114–126. [Google Scholar] [CrossRef]
  60. Huang, W.; Guo, H.L.; Deng, X.; Zhu, T.T.; Xiong, J.F.; Xu, Y.H.; Xu, Y. Short-chain fatty acids inhibit oxidative stress and inflammation in mesangial cells induced by high glucose and lipopolysaccharide. Exp. Clin. Endocr. Diab. 2017, 125, 98–105. [Google Scholar] [CrossRef]
Agriculture 13 01780 g001
Figure 1. Effects of GCT on antioxidant status and endotoxin concentration in serum. (A) GSH-Px; (B) total superoxide dismutase (T-SOD); (C) catalase (CAT); (D) malondialdehyde (MDA); (E) endotoxin (ET). CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT. Values are mean ± standard error (n = 6). * p < 0.05.
Figure 1. Effects of GCT on antioxidant status and endotoxin concentration in serum. (A) GSH-Px; (B) total superoxide dismutase (T-SOD); (C) catalase (CAT); (D) malondialdehyde (MDA); (E) endotoxin (ET). CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT. Values are mean ± standard error (n = 6). * p < 0.05.
Agriculture 13 01780 g001
Agriculture 13 01780 g002
Figure 2. Effects of GCT on intestinal antioxidant status. (A) Glutathione peroxidase (GSH-Px); (B) total superoxide dismutase (T-SOD); (C) catalase (CAT); (D) malondialdehyde (MDA). CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT. Values are mean ± standard error (n = 6). # 0.05 ≤ p < 0.10, * p < 0.05.
Figure 2. Effects of GCT on intestinal antioxidant status. (A) Glutathione peroxidase (GSH-Px); (B) total superoxide dismutase (T-SOD); (C) catalase (CAT); (D) malondialdehyde (MDA). CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT. Values are mean ± standard error (n = 6). # 0.05 ≤ p < 0.10, * p < 0.05.
Agriculture 13 01780 g002
Agriculture 13 01780 g003
Figure 3. Effects of GCT on expression of antioxidant genes in intestine. (A) Sirt1; (B) Nrf2; (C) HO-1; (D) CAT; (E) SOD1; (F) SOD2; (G) GPX1; (H) NQO1. CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT. Values are mean ± standard error (n = 6). # 0.05 ≤ p < 0.10, * p < 0.05, ** p < 0.01.
Figure 3. Effects of GCT on expression of antioxidant genes in intestine. (A) Sirt1; (B) Nrf2; (C) HO-1; (D) CAT; (E) SOD1; (F) SOD2; (G) GPX1; (H) NQO1. CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT. Values are mean ± standard error (n = 6). # 0.05 ≤ p < 0.10, * p < 0.05, ** p < 0.01.
Agriculture 13 01780 g003
Agriculture 13 01780 g004
Figure 4. Effects of GCT on SCFA concentrations and pH values of cecal contents. (A) pH value; (B) acetate; (C) propionate; (D) butyrate; (E) total SCFAs. CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT. Values are mean ± standard error (n = 6). # 0.05 ≤ p < 0.10, * p < 0.05.
Figure 4. Effects of GCT on SCFA concentrations and pH values of cecal contents. (A) pH value; (B) acetate; (C) propionate; (D) butyrate; (E) total SCFAs. CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT. Values are mean ± standard error (n = 6). # 0.05 ≤ p < 0.10, * p < 0.05.
Agriculture 13 01780 g004
Agriculture 13 01780 g005
Figure 5. The results for the phylum level of relative abundance (top 10); CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT.
Figure 5. The results for the phylum level of relative abundance (top 10); CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT.
Agriculture 13 01780 g005
Agriculture 13 01780 g006
Figure 6. Relative abundances at the genus level (top 20); CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT.
Figure 6. Relative abundances at the genus level (top 20); CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT.
Agriculture 13 01780 g006
Agriculture 13 01780 g007
Figure 7. Results of PCoA analysis. CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT.
Figure 7. Results of PCoA analysis. CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT.
Agriculture 13 01780 g007
Agriculture 13 01780 g008
Figure 8. Effect of GCT on microbial diversity in cecal digesta. (A) Observed-species; (B) Shannon index; (C) Simpson index; (D) Chao1 index; (E) ACE index. CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT. Values are mean ± standard error (n = 6). * p < 0.05.
Figure 8. Effect of GCT on microbial diversity in cecal digesta. (A) Observed-species; (B) Shannon index; (C) Simpson index; (D) Chao1 index; (E) ACE index. CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT. Values are mean ± standard error (n = 6). * p < 0.05.
Agriculture 13 01780 g008
Table 1. Ingredient composition and nutrient levels of basal diets (as-fed basis).
Table 1. Ingredient composition and nutrient levels of basal diets (as-fed basis).
ItemsPhases
0–21 d21–42 d
Ingredients, g/kg
Wheat bran119.8129.8
Soybean meal, 44% CP137.7101.8
Corn gluten meal39.939.9
Limestone17.017.0
Corn starch residue79.999.8
L-Lysine HCl, 76.8%10.010.0
Extruded soybean15.021.0
Phytase1.01.0
Calcium monophosphate11.011.0
L-Threonine, 98%1.01.0
DL-Methionine, 98%2.02.0
Choline1.01.0
Sodium chloride4.04.0
Trace mineral premix 11.01.0
Vitamin premix 20.20.2
Complex enzyme0.20.2
Antioxidant0.20.2
Corn559.1559.1
Total1 kg1 kg
Calculated analysis, g/kg
Metabolizable energy, MJ/kg123.3125.0
Crude protein194.7179.3
Crude fat34.537.4
Calcium9.48.7
Available phosphorus3.53.3
Lysine11.510.0
Methionine5.04.0
1 The complete base diet contained, as trace minerals per kilogram, 0.3 mg of Se as Na2SeO3, 1.1 mg of I as Ca (IO3)2, 100 mg of Fe as FeSO4, 65 mg of Zn as ZnSO4, 100 mg of Mn as MnSO4 and 10 mg of Cu as CuSO4. 2 The complete base diet contained, as vitamins per kilogram, 10,000 IU vitamin A, 30 IU vitamin E, 3000 IU vitamin D3, 0.2 mg D-biotin, 1.3 mg menadione, 10 mg D-calcium pantothenate, 40 mg folic acid, 2.2 mg thiamine, 4 mg pyridoxine, 0.025 mg vitamin B12, 40 mg niacin, and 8 mg riboflavin.
Table 2. Primer sequences used for quantitative real-time PCR and 16S PCR amplification.
Table 2. Primer sequences used for quantitative real-time PCR and 16S PCR amplification.
Genes bPrimer Sequences, 5′-3′ aSize, bp
β-actinF:ATTGTCCACCGCAAATGCTTC
R:AAATAAAGCCATGCCAATCTCGTC		113
NQO1F:GAGTGCTTTGTCTACGAGATGGA
R:ATCAGGTCAGCCGCTTCAATC		104
Sirt1F:CACGCCTTGCTGTAGACTTCC
R:ATGAACTTGTGGCAGAGAGATGG		148
HO-1F:GTCCCGAATGAATGCCCTTGA
R:ATGACCGTTCTCCTGGCTCTT		139
Nrf2F:CACGCCTTGCTGTAGACTTCC
R:ATGAACTTGTGGCAGAGAGATGG		109
GPX1F:CGGCTTCAAACCCAACTTCAC
R:CTCTCTCAGGAAGGCGAACAG		85
SOD1F:CGCAGGTGCTCACTTCAATCC
R:CAGTCACATTGCCGAGGTCAC		89
CATF:GGAGGTAGAACAGATGGCGTATG
R:CGATGTCTATGCGTGTCAGGAT		114
SOD2F:GCTGTATCAGTTGGTGTTCAAGGA
R:GCAATGGAATGAGACCTGTTGTTC		130
16S515F:GTGCCAGCMGCCGCGGTAA
806R:GGACTACHVGGGTWTCTAAT		291
a F: forward primer; R: reverse primer. b NQO1, NAD(P)H quinone oxidoreductase 1; Sirt1, sirtuin1; HO-1, heme-oxygenase 1; Nrf2, nuclear factor erythroid 2-related factor 2; GPX1, glutathione peroxidase-1; SOD1, superoxide dismutase 1; CAT, catalase; SOD2, superoxide dismutase 2; 16S, 16S rDNA.
Table 3. The relative abundance of cecal microbiota at the phylum level (top 10).
Table 3. The relative abundance of cecal microbiota at the phylum level (top 10).
Items (%)Treatment 1p Value
CONGCT
Bacteroidota32.23 ± 4.3532.93 ± 3.700.905
Firmicutes32.19 ± 2.7935.36 ± 4.580.571
Verrucomicrobiota2.99 ± 1.656.15 ± 5.100.572
Euryarchaeota8.08 ± 4.960.04 ± 0.040.181
Desulfobacterota7.75 ± 1.664.12 ± 1.890.186
Synergistota3.20 ± 1.432.36 ± 1.070.653
Halobacterota2.56 ± 1.283.51 ± 1.030.578
Fusobacteriota0.10 ± 0.060.86 ± 0.840.417
Unidentified_Bacteria2.56 ± 0.351.71 ± 0.190.078
Campylobacterota1.08 ± 0.620.58 ± 0.160.461
Others7.26 ± 0.6812.35 ± 3.670.240
1 CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT.
Table 4. The relative abundance of cecal microbiota at the genus level (top 20).
Table 4. The relative abundance of cecal microbiota at the genus level (top 20).
Items (%)Treatment 1p Value
CONGCT
Akkermansia2.95 ± 1.675.54 ± 5.220.649
Methanobrevibacter8.08 ± 4.960.04 ± 0.040.181
Alistipes16.07 ± 1.6914.69 ± 2.710.577
Bacteroides6.33 ± 3.967.33 ± 2.540.838
Prevotellaceae_UCG-0012.50 ± 2.301.73 ± 0.900.761
Desulfovibrio6.95 ± 1.543.66 ± 1.850.209
Ligilactobacillus0.54 ± 0.211.86 ± 1.680.460
Synergistes3.20 ± 1.432.36 ± 1.070.653
Barnesiella2.80 ± 1.322.97 ± 1.340.933
Faecalibacterium2.97 ± 0.565.75 ± 0.580.009
Megamonas0.43 ± 0.093.20 ± 1.160.044
Methanocorpusculum2.56 ± 1.283.51 ± 1.030.578
Parabacteroides1.27 ± 0.362.99 ± 1.050.183
Butyricicoccus0.35 ± 0.111.43 ± 1.110.388
Fusobacterium0.10 ± 0.060.86 ± 0.830.417
[Ruminococcus]_torques_group1.85 ± 0.352.43 ± 0.630.435
Helicobacter1.06 ± 0.620.57 ± 0.160.468
CHKCI0011.20 ± 0.440.27 ± 0.070.102
Colidextribacter0.51 ± 0.060.63 ± 0.270.693
Romboutsia0.91 ± 0.210.57 ± 0.240.324
1 CON, broilers of control group fed a basal diet; GCT, broilers of GCT group fed a basal diet with 300 mg/kg GCT.
Table 5. The results of ANOSIM analysis of microbial community structure.
Table 5. The results of ANOSIM analysis of microbial community structure.
Group-PairR-Valuep Value
CON vs. GCT0.0940.150
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yuan, P.; Ren, X.; Niu, J.; Liu, Y.; Huang, L.; Jiang, S.; Jiao, N.; Yuan, X.; Yang, W.; Li, Y. Effects of Dietary Galla Chinensis Tannin Supplementation on Antioxidant Capacity and Intestinal Microbiota Composition in Broilers. Agriculture 2023, 13, 1780. https://doi.org/10.3390/agriculture13091780

AMA Style

Yuan P, Ren X, Niu J, Liu Y, Huang L, Jiang S, Jiao N, Yuan X, Yang W, Li Y. Effects of Dietary Galla Chinensis Tannin Supplementation on Antioxidant Capacity and Intestinal Microbiota Composition in Broilers. Agriculture. 2023; 13(9):1780. https://doi.org/10.3390/agriculture13091780

Chicago/Turabian Style

Yuan, Peng, Xiaojie Ren, Jiaxing Niu, Yang Liu, Libo Huang, Shuzhen Jiang, Ning Jiao, Xuejun Yuan, Weiren Yang, and Yang Li. 2023. "Effects of Dietary Galla Chinensis Tannin Supplementation on Antioxidant Capacity and Intestinal Microbiota Composition in Broilers" Agriculture 13, no. 9: 1780. https://doi.org/10.3390/agriculture13091780

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop