Next Article in Journal
Assessment of Heavy Metal Contamination in Beach Sediments of Eastern St. Martin’s Island, Bangladesh: Implications for Environmental and Human Health Risks
Next Article in Special Issue
A Comprehensive Review on Metallic Trace Elements Toxicity in Fishes and Potential Remedial Measures
Previous Article in Journal
Numerical Simulation of the Lower and Middle Reaches of the Yarkant River (China) Using MIKE SHE
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Water
Volume 15
Issue 13
10.3390/w15132493
water-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Different Submerged Macrophytes on the Water and Sediment in Aquaculture Ponds with Enrofloxacin Residues

by
Lingling Zhang
,
Lizao Liu
and
Yuping Zhang
*
Shanghai Fisheries Research Institute, Shanghai Fisheries Technical Extension Station, Shanghai 200433, China
*
Author to whom correspondence should be addressed.
Water 2023, 15(13), 2493; https://doi.org/10.3390/w15132493
Submission received: 4 May 2023 / Revised: 4 July 2023 / Accepted: 4 July 2023 / Published: 7 July 2023
(This article belongs to the Special Issue Aquatic Ecotoxicology: A Tool for Monitoring the Effects of Anthropogenic Chemical Contamination on Fisheries and Aquaculture)
Browse Figures
Review Reports Versions Notes

Abstract

:
Submerged macrophyes have been widely used to restore aquaculture ponds in recent years. Yet, whether the residual antibiotics in ponds will affect the remediation effect of submerged macrophyes, and the effect of different submerged macrophyes on the water and sediment in aquaculture ponds with antibiotic residues, is unclear. A microcosm experiment was carried out to study the interaction between three kinds of submerged macrophytes and their growing environment with antibiotic residues. Ceratophyllum demersum L. with no roots, Vallisneria spiralis L. with flourish roots, and Hydrilla verticillata L with little roots were chosen to be planted in the sediment added with enrofloxacin (ENR). The growth of submerged macrophytes, the changes of the overlying water and sediment characteristics, and the microbial community in the sediment were analyzed. The results showed that according to the growth rate and nutrients accumulation ability, V. spiralis with flourish roots performed best among the three submerged macrophytes. The concentrations of TOC, TP, NH4+-N, and TN in the overlying water were 25.0%, 71.7%, 38.1%, and 24.8% lower in the V. spiralis treatment comparing with the control, respectively. The richness and diversity of the microorganisms in the sediment of V. spiralis treatment were significantly higher than those in the control, but this advantage was not obvious in the H. verticillata treatment. V. spiralis promoted the growth of Proteobacteria (22.8%) and inhibited the growth of Acidobacteria (32.1%) and Chloflexi (31.7%) in the rhizosphere sediment with ENR residue. The effects of the three submerged macrophytes on the removal of ENR from sediment were not reflected due to the limitation of water depth. Compared with C. demersum and H. verticillata, V. spiralis was more suitable for the remediation of the aquaculture ponds with ENR residue.

1. Introduction

Aquaculture has become the main source of aquatic protein for humans [1]. Its rapid development faces challenges, such as disease control and environmental pollution, especially in high-density aquaculture farms [2]. The negative effects of nutrients released by aquaculture to aquatic ecosystems are increasingly attracting human attention. On the one hand, dissolved inorganic nutrients such as ammonia and phosphate produced by aquaculture can be absorbed by phytoplankton and macroalgae, which can stimulate their growth. The enhanced production may lead to harmful algal blooms [3]. On the other hand, antibiotics are added into aquaculture ponds, one side for diminishing disease appearance, another for increasing the survival and mean weight of animals [4], while aquaculture ponds polluted by over-used antibiotics are considered to be a notorious source of antibiotic resistance genes (ARGs), which are harmful for the environment and humans and have been recognized as one of the most critical public health concerns of the 21st century by the World Health Organization [5,6]. Xu et al. [7] demonstrated that antibiotics significantly changed the microbial composition of the rhizosphere and had a profound effect on the nitrogen and carbon cycling in the microenvironment formed by the plant–microbe system. Antibiotics also can be taken up by aquatic organisms and retained in their bodies. Currently, antibiotics have been detected in various aquatic organisms, such as fish, bivalves, gastropods, crustaceans, and macroalgae [8,9]. Ecotoxicological studies indicate that antibiotics may cause genotoxicity, phototoxicity, and oxidative stress in aquatic organisms [6]. Previous studies showed that the administration of antibiotics to fish can have great impact on gut microbial community by reducing their diversity and number [10]. ENR affected the carbon fixation and assimilation processes of algae (Scenedesmus obliquus) by damaging their photosystem [11], and high concentration of ENR triggered metabolic disturbance in rice seedlings [12].
To date, the treatment of wastewater from aquaculture has received widespread attention. Lots of physical, chemical, and biological technologies such as constructed wetlands, microalgae, submerged macrophytes, ultraviolet photolysis, and immobilized microbial granules were researched for the removal of nutrients or antibiotics from aquaculture [11,13,14,15,16]. Submerged macrophytes are an environmentally friendly, effective, and low-cost restoration technology. They can remove nutrients (especially N and P) from both water and sediment [14]. A previous study showed that a subtropical aquacultural lake was restored successfully by submerged macrophytes through controlling the internal phosphorus loading [17]. As a result, more and more aquaculture farms choose planting submerged macrophytes in aquaculture ponds to control the water and sediment quality.
The residue antibiotics in the aquaculture ponds may influence the growth of submerged macrophytes, leading to different remediation effects. In a recent review, antibiotics were concluded to increase the root activities and exudates of plants in constructed wetlands [18]. Xu et al. [7] showed that low-dose antibiotics (sulfamethoxazole and ofloxacin) increased the root activity of Cyperus involucratus, but high-dose antibiotics (higher than 1 mg/L) produced toxic stress effects. The effects of ENR on V. spiralis also show the pattern of “low-dose-promotion and high-dose-inhibition” [14,19]. Thus, the effects of antibiotics on plants may be related to antibiotic concentrations and plant species. The growth and water purification efficiencies of different submerged macrophytes need to be compared when being used to remediate the aquaculture ponds with antibiotic residues. In turn, the growth and nutrients absorption of submerged macrophytes also changed the physi-chemical condition and microbial community in the aquaculture ponds, which may affect the pollutants (including antibiotics) removal from the water and sediment. Thus, the interaction among the submerged macrophytes, water and sediment characteristics, and the microbial community in the aquaculture ponds with antibiotics, needs more research.
As a synthetic third generation quinolone broad-spectrum antibiotic, ENR has been reported to be used in 5 among the 6 top aquaculture-producing countries [20]. So, it was chosen in this study. The main objectives of this study were to: (1) evaluate the effects of ENR on the growth of submerged macrophytes with distinct root morphology; (2) assess the changes of the overlying water and sediment characteristics; and (3) explore the microorganism in the sediment influenced by the plant species and ENR residues.

2. Material and Methods

2.1. Experimental Mesocosms

Twelve PVC tanks (0.4 m × 0.4 m × 0.6 m) were used for the experiment in a transparent glass greenhouse located in the downtown area of Shanghai, China (Figure 1a). Four treatments were set up with three replicates for each: (1) T1: planted with Ceratophyllum demersum L. (C. demersum); (2) T2: planted with V. spiralis; (3) T3: planted with Hydrilla verticillata L. (H. verticillata) and (4) unplanted treatment (control). These three kinds of submerged macrophytes were common and easily obtained, but they have a distinct morphology (Figure 1b). The roots of V. spiralis are fine and flourish. The stems of H. verticillata can survive and grow new roots. C. demersum has no root. One hundred g fresh weight of submerged macrophytes were planted in each tank.
The top 10 cm of the sediment in a shrimp pond of Fengxian in Shanghai was collected and mixed thoroughly. The sediment characteristics were as follows, total nitrogen (TN) 2.36 ± 0.18 g/kg DW, total organic carbon (TOC) 25.0 ± 2.95 g/kg DW, total phosphorus (TP) 1.66 ± 0.21 g/kg dry weight (DW), zinc (Zn) 141.5 ± 12.8 mg/kg DW, copper (Cu) 70.1 ± 6.01 mg/kg DW, lead (Pb) 28.6 ± 2.37 mg/kg DW, chromium (Cr) 40.4 ± 4.23 mg/kg DW, cadmium (Cd) 0.35 ± 0.03 mg/kg DW and arsenic (As) 6.38 ± 0.47 mg/kg DW, respectively. A 6 cm layer of sediment (about 7.5 kg of wet weight) was laid in each tank, and then 50 mL of ENR solution with a concentration of 100 mg/L was added and mixed with the sediment evenly. Then, the tanks were filled with tap water and which was replenished weekly to compensate for the evaporated water. During the experimental period, the water temperature was between 19.2 and 33.9 °C with an average value of 26.8 °C.

2.2. Sampling and Analysis

The experiment was carried out from 1 June to 20 September 2018. Water samples were collected and analyzed every 4–14 days. The mixture of the wet sediment samples from the center and four corners of each tank were collected at the beginning and end of the experiment. Part of the sediment was freeze-dried for the characteristics determined, and the rest was stored at −80 °C until microbial community analysis. Detailed determination methods for water (TOC, TP, TN and NH4+-N) and sediment (TN, TP, TOC, ENR and CIP) samples were described in our previous study [14]. All of the submerged macrophytes were harvested and weighed at the end of the experiment. The samples were powdered after freeze-drying (FD-1A-50, Hanno, Shanghai, China). Then, the N and P concentrations were determined according to Zhang et al. [14].

2.3. DNA Extraction and High throughout Sequencing

The analysis of microbial community in the sediment samples was using High Throughput Sequencing technology. DNA extraction and Illumina MiSeq sequencing were conducted by Shanghai Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China). DNA extraction was performed using E.Z.N.A. Soil DNA Kit (Omega, Bio-tek, Norcross, GA, USA). The DNA concentration and purity were determined with NanoDrop 2000 UV-vis spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The 16S rRNA V3 and V4 regions were amplified with two universal primers: 338F primer (ACTCCTACGGGAGGCAGCAG) and 806R primer (GGACTACHVGGGTWTCTAAT) by an ABI GeneAmp® 9700 PCR thermocycler (ABI, Los Angeles, CA, USA). Sequencing was performed using the Illumina MiSeq system (Illumina, San Diego, CA, USA), following the manufacturer’s instructions. The data were analyzed on the free online platform of Majorbio I-Sanger Cloud Platform (cloud.majorbio.com (accessed on 20 November 2019)). The detailed analysis methods in this section were introduced in Nie et al. [21].

2.4. Statistical Analysis

Differences in the growth of the three kinds of submerged macrophytes and the characteristics of the sediment were evaluated by one-way ANOVA. Two-way ANOVA at the level of 0.05 with treatments and sampling time as factors was performed to compare the water parameters among the four treatments. All the statistical analysis and graphing were carried out using SPSS 24.0 and Origin 8.0.

3. Results and Discussion

3.1. Growth of Submerged Macrophytes

Fresh weight and relative growth rate (RGR) are important indicators for plant growth. It can be seen from Figure 2A that the harvested fresh weight and RGR of V. spiralis (1.76 ± 0.37 kg/m2, 0.0093 ± 0.0020 d−1, respectively) were significantly higher than those of the other two species (p < 0.05). Comparing the nutrients accumulation of the three submerged macrophytes, the accumulated N of V. spiralis (2.93 ± 0.73 g/m2) and H. verticillata (3.10 ± 0.39 g/m2) were significantly higher than that of C. demersum (1.29 ± 0.30 g/m2, p < 0.05). The P accumulated ability of V. spiralis (2.64 ± 0.55 g/m2) was also much higher than that of C. demersum (1.37 ± 0.48 g/m2, Figure 2B). The results may be explained by the morphological differences among the three submerged macrophytes. On one hand, the roots of V. spiralis and H. verticillata can absorb nutrients directly from sediment, while C. demersum has no root. On the other hand, a previous study showed that the submerged macrophytes with flat-leaf type (V. spiralis and H. verticillata) possessed a greater photosynthetic compared with the needle-leaf types (C. demersum) [22]. Greater photosynthetic may lead to more N and P absorption. Thus, according to the growth rate and nutrients accumulated ability, V. spiralis performed best in the three submerged macrophytes.

3.2. Overlying Water Quality

The decrease of TOC concentration in the overlying water of C. demersum treatment was obvious in the early 50 days of the experiment (Figure 3a). C. demersum has no root and floated in the top layer of water, the photosynthesis of which may be obviously higher than the other two species in this period because of the stronger light illumination, but this advantage disappeared when the leaves of V. spiralis and H. verticillata grew to flourish (50 days later). The mean concentrations of TOC in the overlying water of the three planted treatments were 26.6%, 24.3% and 22.1% lower than that of the Control 50 days later, respectively. The submerged macrophytes changed the redox environment of the water by increasing dissolved oxygen (DO) concentration, while the removal rates of organic matter in water depend on the DO levels available to the bacteria [23]. This can explain the lower TOC concentrations in the three planted treatments.
TP concentrations in the control increased gradually with time, indicating the continuous release of P from the sediment (Figure 3b). The effect of V. spiralis on reducing TP concentrations in the overlying water was obvious. The average TP concentration was 0.16 ± 0.04 mg/L in V. spiralis treatment, which was significantly lower than that of the C. demersum treatment (0.39 ± 0.08 mg/L), the H. verticillata treatment (0.56 ± 0.04 mg/L) and the control (0.55 ± 0.11 mg/L, p < 0.05, Figure 3b). On the one hand, more biomass of V. spiralis could absorb more P from the water, which can be seen from Figure 2B. On the other hand, submerged macrophytes can inhibit the release of P from the sediment into the overlying water effectively, which depended on the DO level in the bottom water [17]. The study of Zhu et al. [23] showed that photosynthesis of V. spiralis changed the redox environment of the water by increasing DO concentration. Thus, much more biomass of V. spiralis may absorb more P from the water; meanwhile, decreased has more P released from the sediment. The TOC and TP concentrations in the overlying water were significantly higher in the H. verticillata treatment (early 50 days) than those in the other three treatments (p < 0.05, Figure 3a,b). It was probably due to the fact that the stems of H. verticillata were cut into sections before planting, some of which decayed, causing the increase of organic matter and P concentrations in the overlying water.
The concentrations of TN decreased in the early 20 days and later on, basically remained stable in the four treatments. At the end of the experiment, the TN removal efficiencies from overlying water were 73.4%, 86.0% 79.6% and 46.7% for C. demersum, V. spiralis, H. verticillata and the control, respectively (Figure 3c). NH4+-N concentrations in the overlying water basically increased in the four treatments. The average value was 0.051 ± 0.014 mg/L in the C. demersum treatment, which was significantly lower than that in the control (0.102 ± 0.011 mg/L, p < 0.05, Figure 3d).
To sum up, V. spiralis performed best on the overlying water quality among the three submerged macrophytes grown in the sediment with ENR. The concentrations of TOC, TP, TN and NH4+-N were 25.0%, 71.7%, 24.8% and 38.1% lower in the V. spiralis treatment than those in the control, respectively. A previous study of Liu et al. [22] found that the flat-leaf types (V. spiralis and H. verticillata) performed better than the needle-leaf types (C. demersum) in the improvements of underwater light conditions and water quality. Moreover, much more biomass and higher RGR made V. spiralis perform better than H. verticillata in the present study.

3.3. Effects of Submerged Macrophytes on the Sediment Characteristics

The concentration of TOC in the sediment of the V. spiralis treatment was slightly lower than those of the other treatments, which may be related to the developed roots of V. spiralis (Figure 4a). The roots of V. spiralis displayed strong oxidation potential, its growth increased O2 concentration in the sediment and which was mainly due to the radial oxygen loss (ROL) from the root system [24]. The rates of radial oxygen loss (ROL) from the roots of V. spiralis were calculated, ranging between 58.3 and 658 μmol m−2 h−1 [25,26]. Gu et al. [27] showed that the plants with extensive aerenchyma tissue transported excess oxygen to roots and diffused into their surroundings, forming an oxidation-reduction micro-environment in the rhizosphere of constructed wetlands. They also found that the plants with higher ROL exhibited better nutrients and organic matter removal than did the other plant species. Aerobic degradation of organic matter by microorganisms contributed to the change of organic matter content in the sediment [28]. The oxygen secretion and exudates of the roots was beneficial to the reproduction of aerobic bacteria.
TN and TP concentrations in the sediment of the four treatments changed little at the end of the experiment compared with the background values (Figure 4b). On the one hand, better remediation performance under a high background concentration of TN and TP in the sediment may need a longer time [14]. This may be the main reason. TN and TP concentrations in the sediment reached several g/kg DW in this study. On the other hand, the removal of N and P may be inhibited by the ENR and CIP in the sediment. Ohore et al. [18] showed that the N and P removal efficiencies were decreased 22% and 9.3% by antibiotics in the constructed wetlands. It concluded that the impact of antibiotics on microbes affected the N removal directly in constructed wetlands [18].
The total removal efficiencies of ENR and CIP were 12.3%, 40.8%, 41.9% and 61.0% in the sediment of the four treatments (Figure 4). The removal ability of the control was the highest, followed by the two rooted submerged macrophytes treatments, and C. demersum with no root was the lowest. Lin et al. [29] reported that natural irradiation plays a major role in the degradation of ENR and CIP in the water and sediment, with biodegradation playing just a minor role. The depth of the water in this study was no more than 60 cm, which may facilitate the photodegradation of ENR and CIP in the sediment of the control. The covering of submerged macrophytes hindered the photodegradation of ENR and CIP in the sediment of the three planted treatments. Especially for the C. demersum, it has the greatest blocking effect on the water, leading to the lowest ENR and CIP removal. It can be speculated that photodegradation by solar radiation contributed more to the ENR and CIP removal than submerged macrophytes and microbial degradation in the present study. On the other hand, plant absorption and diffusion into the overlying water also contributed to the decrease of ENR and CIP in the sediment of the planted treatments [14,30].

3.4. Effects of Plant Species on the Microorganism in Sediment with ENR

Table 1 showed the Alpha Diversity Index for the sediment samples from the four treatments. The values of Good’s coverage index were all higher than 0.984, suggesting that the depth of sequencing covered the majority of species in the samples. Table 1 shows that the number of OTUs in the sediment of the three planted treatments was more than that of the control, especially the sample of the V. spiralis treatment (p < 0.05). V. spiralis treatment contained more unique OTUs (144) than those in the other three treatments (59, 39 and 27, respectively). The Chao1 and ACE index of microbial communities in the sediment suggested that the richness and diversity of the microorganisms in the planted treatments were also significantly higher than those in the control, except for the H. verticillata treatment, in which the Chao1 and ACE indexes were comparable to the control (Table 1). Compared with the Control, V. spiralis induced an increase of 21.7% for the number of OUTs, 17.8% for Chao1 index and 19.3% for the ACE index of the microbial community in the sediment with ENR residues. There was also no significant difference, but higher numbers of OTUs and higher values of the Chao1 estimator, ACE and Shannon indexes were observed for bacterial communities in the H. verticillata microcosms compared to the C. demersum microcosms in a previous study [31]. The author explained that it was due to the direct influence of rooted H. verticillata on the sediment microbial community by oxygen release and organics secretion. This was consistent with our view that the roots promoted the microbial communities. We speculated that the inhibitory effect of ENR on microorganisms in the sediment may lead to the opposite results in this research. Therefore, the planting of submerged macrophytes, especially V. spiralis, increased the richness and diversity of the microbial communities in the sediment with ENR and CIP, which also played an important role in the construction of the unique microbial population [23]. The results of Man et al. [32] also showed that wetland plants formed the stability of rhizosphere microorganisms and increased their ability to tolerate antibiotics stress.
Apart from bacterial community richness and diversity, the microbial community structure of the sediment in the four treatments was also analyzed at the phylum and genus level (Figure 5). The development of submerged vegetation significantly influenced the bacterial community structure in the sediment [33]. Proteobacteria, Acidobacteria and Chloflexi were the dominated phylotypes in the sediment of this study, accounting for 70.8–72.8% of the microbial community, which was similar with the results of Chao et al. [34]. The relative abundance of Proteobacteria in V. spiralis treatment (47.9%) was higher than that in the C. demersum treatment (43.5%), H. verticillata treatment (38.1%) and control (39.0%). Similar to this result, Ohore et al. [35] found that CIP caused an increase in the relative abundance of Proteobacteria in the epiphytic biofilm on V. spiralis, while the relative abundance of Acidobacteria and Chloflexi were lower in V. spiralis treatment compared with the other three treatments (Figure 5). Thus, V. spiralis promoted the growth of Proteobacteria and inhibited the growth of Acidobacteria and Chloflexi in the rhizosphere sediment with ENR.
At the genus level, the relative abundance of norank_f_Anaerolineaceae and norank_c_Acidobacteria in the V. spiralis treatment was lower than that in the other three treatments. Wang et al. [33] showed that norank_c_Acidobacteria and norank_f_Anaerolineaceae which are related to organic carbon degradation, were significantly lower during the high macrophyte biomass period. Submerged macrophytes recruited and selected bacteria instead of randomly obtaining bacteria from surrounding environments. Although bacteria from surrounding environments could randomly meet the root surface of submerged macrophytes, the hydrophytes determined and derived who would dwell and develop in epiphytic microbiomes [36]. The oxygen released by the roots of V. spiralis promotes a more oxidized rhizosphere environment [26]. The changed environmental condition reduced the growth and reproduction of anaerobic bacteria in the root region. Pseudomonas is a genus that was endemic to the V. spiralis and C. demersum treatments, but not to the other two (Figure 6). Pseudomonas was identified as a typical denitrifying heterotroph; the sufficient carbon source was beneficial for their growth and reproduction [37,38]. It has been well known that the root exudates and decaying tissues of aquatic plants can supply organic matters for the growth of heterotrophic bacteria which help them outcompete the slow-growing autotrophic bacteria [39]. As a resistant bacterium, Pseudomonas was widely distributed in the antibiotic contaminated environment and exhibited multidrug resistance towards antibiotics [40]. Thus, more organic matters produced by well-developed aquatic vegetation and the resistance towards antibiotics were beneficial for the growth of Pseudomonas at the rhizosphere of submerged macrophytes.
In general, the results above concluded that compared with the other two submerged macrophytes, V. spiralis showed a more significant effect on the diversity and structure of microbial communities in the sediment with ENR and CIP.

4. Conclusions

Three kinds of submerged macrophyte with distinct root morphology (flourish roots, little roots and no roots) were chosen to restore the aquaculture ponds with enrofloxacin (ENR) residues. According to the growth rate, nutrients accumulation and water purification ability, V. spiralis with flourish roots performed best among the three submerged macrophytes. The TOC, TP, NH4+-N and TN concentrations in the overlying water were decreased by V. spiralis with 25.0%, 71.7%, 38.1% and 24.8%, respectively. The planting of V. spiralis also increased the richness and diversity of the microorganisms in the sediment with 21.7% for the number of OUTs, 17.8% for Chao1 index and 19.3% for ACE index. V. spiralis promoted the growth of Proteobacteria and inhibited the growth of Acidobacteria and Chloflexi in the rhizosphere sediment. Compared with C. demersum and H. verticillata, V. spiralis was more suitable for the restoration of the aquaculture ponds with ENR residue. Our results add to understanding the influences of submerged macrophytes on nutrients removal and the microbial community in aquaculture ponds with antibiotic residues. However, due to the limitations of the water depth in this study, the effect of submerged macrophytes on the removal of ENR was not clear. Further studies are needed to explore the ENR removal efficiencies by different submerged macrophytes and related mechanisms such as the effect of released oxygen and exudates from the roots on the removal of antibiotics.

Author Contributions

Methodology, L.Z. and Y.Z.; Investigation, L.Z. and L.L.; Formal analysis, L.Z. and L.L.; Writing—original draft, L.Z.; Writing—editing, L.Z.; Resources, Y.Z.; Supervision, Y.Z.; Writing—review, Y.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the Nature Science Foundation of Shanghai, China (20ZR1450800) and the National Nature Science Foundation of China (51709172 and 31900097).

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. FAO. The State of World Fisheries and Aquaculture 2020. In Sustainability in Action; FAO: Rome, Italy, 2020; Volume 32, p. 244. [Google Scholar] [CrossRef]
  2. Naylor, R.L.; Hardy, R.W.; Buschmann, A.H.; Bush, S.R.; Cao, L.; Klinger, D.H.; Little, D.C.; Lubchenco, J.; Shumway, S.E.; Troell, M. A 20-year retrospective review of global aquaculture. Nature 2021, 591, 551–563. [Google Scholar] [CrossRef]
  3. Wang, J.; Beusen, A.H.W.; Liu, X.; Bouwman, A.F. Aquaculture Production is a Large, Spatially Concentrated Source of Nutrients in Chinese Freshwater and Coastal Seas. Environ. Sci. Technol. 2019, 54, 1464–1474. [Google Scholar] [CrossRef]
  4. Amable, V.I.; Amarilla, M.J.V.; Salas, P.L.; Mendoza, J.A.; Falcón, S.L.; Boehringer, S.I.; Sánchez, S.; Guidoli, M.G. Fluoro-quinolones and tetracyclines as growth factors in aquaculture: Increase of biometrical parameters versus emergence of resistant bacteria and residues in meat. Aquaculture 2022, 561, 738640. [Google Scholar] [CrossRef]
  5. Jin, X.; Liu, S.; Zhang, Z.; Liu, T.; Li, N.; Liang, Y.; Zheng, J.; Peng, N. Enrofloxacin-induced transfer of multiple-antibiotic resistance genes and emergence of novel resistant bacteria in red swamp crayfish guts and pond sediments. J. Hazard. Mater. 2023, 443, 130261. [Google Scholar] [CrossRef] [PubMed]
  6. Zhu, M.H.; Chen, J.W.; Peijnenburg, W.J.G.M.; Xie, H.J.; Wang, Z.Y.; Zhang, S.Y. Controlling factors and toxicokinetic modeling of antibiotics bioaccumulation in aquatic organisms: A review. Crit. Rev. Environ. Sci. Technol. 2023, 53, 1431–1451. [Google Scholar] [CrossRef]
  7. Xu, J.; Liu, X.; Lv, Y.; Guo, X.; Lu, S. Response of Cyperus involucratus to sulfamethoxazole and ofloxacin-contaminated envi-ronments: Growth physiology, transportation, and microbial community. Ecotoxicol. Environ. Saf. 2020, 206, 111332. [Google Scholar] [CrossRef] [PubMed]
  8. Swiacka, K.; Maculewicz, J.; Kowalska, D.; Caban, M.; Smolarz, K.; Swiezak, J. Presence of pharmaceuticals and their me-tabolites in wild-living aquatic organisms—Current state of knowledge. J. Hazard. Mater. 2022, 424, 127350. [Google Scholar] [CrossRef] [PubMed]
  9. Griboff, J.; Carrizo, J.C.; Bonansea, R.I.; Valdés, M.E.; Wunderlin, D.A.; Amé, M.V. Multiantibiotic residues in commercial fish from Argentina. The presence of mixtures of antibiotics in edible fish, a challenge to health risk assessment. Food Chem. 2020, 332, 127380. [Google Scholar] [CrossRef]
  10. Kim, A.; Kim, N.; Roh, H.J.; Chun, W.-K.; Ho, D.T.; Lee, Y.; Kim, D.-H. Administration of antibiotics can cause dysbiosis in fish gut. Aquaculture 2019, 512, 734330. [Google Scholar] [CrossRef]
  11. Li, B.; Jia, R.; Hou, Y.; Zhu, J. Treating performance of a commercial-scale constructed wetland system for aquaculture effluents from intensive inland Micropterus salmoides farm. Front. Mar. Sci. 2022, 9, 1000703. [Google Scholar] [CrossRef]
  12. Xu, L.; Li, Z.; Zhuang, B.; Zhou, F.; Li, Z.; Pan, X.; Xi, H.; Zhao, W.; Liu, H. Enrofloxacin perturbs nitrogen transformation and assimilation in rice seedlings (Oryza sativa L.). Sci. Total. Environ. 2022, 802, 149900. [Google Scholar] [CrossRef]
  13. Kashem, A.H.M.; Das, P.; AbdulQuadir, M.; Khan, S.; Thaher, M.I.; Alghasal, G.; Hawari, A.H.; Al-Jabri, H. Microalgal bio-remediation of brackish aquaculture wastewater. Sci. Total Environ. 2023, 873, 162384. [Google Scholar] [CrossRef]
  14. Zhang, L.L.; Zhang, Y.P.; Liu, L.Z. Effect of submerged macrophytes Vallisneria spiralis L. on restoring the sediment contami-nated by enrofloxacin in aquaculture ponds. Ecol. Eng. 2019, 140, 105596. [Google Scholar] [CrossRef]
  15. Xue, H.H.; Li, M.; Liu, B.S.; Meng, Q.L. Photochemical degradation kinetics and mechanisms of norfloxacin and oxytetracycline. Environ. Sci. Pollut. Res. 2020, 28, 8258–8265. [Google Scholar] [CrossRef]
  16. Sha, S.; Dong, Z.; Gao, Y.; Hashim, H.; Lee, C.T.; Li, C. In-situ removal of residual antibiotics (enrofloxacin) in recirculating aquaculture system: Effect of ultraviolet photolysis plus biodegradation using immobilized microbial granules. J. Clean. Prod. 2022, 333, 130190. [Google Scholar] [CrossRef]
  17. Li, Y.; Wang, L.G.; Chao, C.X.; Yu, H.W.; Yu, D.; Liu, C.H. Submerged macrophytes successfully restored a subtropical aqua-cultural lake by controlling its internal phosphorus loading. Environ. Pollut. 2021, 268, 115949. [Google Scholar] [CrossRef]
  18. Ohore, O.E.; Qin, Z.R.; Sanganyado, E.; Wang, Y.W.; Jiao, X.Y.; Liu, W.H.; Wang, Z. Ecological impact of antibiotics on bio-remediation performance of constructed wetlands: Microbial and plant dynamics, and potential antibiotic resistance genes hotspots. J. Hazard. Mater. 2022, 424, 127495. [Google Scholar] [CrossRef] [PubMed]
  19. Chen, Q.; Jin, L.Q.; Zhong, Y.; Ji, G.H. Effects of Enrofloxacin on the Epiphytic Algal Communities Growing on the Leaf Surface of Vallisneria natans. Antibiotics 2022, 11, 1020. [Google Scholar] [CrossRef]
  20. Limbu, S.M.; Chen, L.; Zhang, M.; Du, Z. A global analysis on the systemic effects of antibiotics in cultured fish and their po-tential human health risk: A review. Rev. Aquacult. 2021, 13, 1015–1059. [Google Scholar] [CrossRef]
  21. Nie, Z.J.; Zheng, Z.W.; Zhu, H.J.; Sun, Y.; Gao, J.; Gao, J.C.; Xu, P.; Xu, G.C. Effects of submerged macrophytes (Elodea nuttallii) on water quality and microbial communities of largemouth bass (Micropterus salmoides) ponds. Front. Microbiol. 2023, 13, 1050699. [Google Scholar] [CrossRef]
  22. Liu, H.; Liu, G.; Xing, W. Functional traits of submerged macrophytes in eutrophic shallow lakes affect their ecological functions. Sci. Total. Environ. 2021, 760, 143332. [Google Scholar] [CrossRef] [PubMed]
  23. Zhu, L.M.; Xu, H.T.; Xiao, W.S.; Lu, J.K.; Lu, D.; Chen, X.Y.; Zheng, X.Y.; Jeppesen, E.; Zhang, W.; Wang, L.Q. Ecotoxicological effects of sulfonamide on and its removal by the submerged plant Vallisneria natans (Lour.) Hara. Water Res. 2020, 170, 115354. [Google Scholar] [CrossRef] [PubMed]
  24. Yan, W.M.; He, X.Y.; Wu, T.F.; Chen, M.S.; Lin, J.; Chen, X.; Li, Q.; Li, M.J.; Yan, Y.L.; Yao, Q. A combined study on Vallisneria spiralis and lanthanum modified bentonite to immobilize arsenic in sediments. Environ. Res. 2023, 216, 114689. [Google Scholar] [CrossRef] [PubMed]
  25. Han, C.; Ren, J.H.; Wang, Z.D.; Yang, S.K.; Ke, F.; Xu, D.; Xie, X.C. Characterization of phosphorus availability in response to radial oxygen losses in the rhizosphere of Vallisneria spiralis. Chemosphere 2018, 208, 740–748. [Google Scholar] [CrossRef] [PubMed]
  26. Marzocchi, U.; Benelli, S.; Larsen, M.; Bartoli, M.; Glud, R.N. Spatial heterogeneity and short-term oxygen dynamics in the rhizosphere of Vallisneria spiralis: Implications for nutrient cycling. Freshw. Biol. 2019, 64, 532–543. [Google Scholar] [CrossRef]
  27. Gu, X.S.; Chen, D.Y.; Wu, F.; Tang, L.; He, S.B.; Zhou, W.L. Function of aquatic plants on nitrogen removal and greenhouse gas emission in enhanced denitrification constructed wetlands: Iris pseudacorus for example. J. Clean. Prod. 2022, 330, 129842. [Google Scholar] [CrossRef]
  28. Liu, Y.L.; Zou, Y.L.Y.; Kong, L.W.; Bai, G.L.; Luo, F.; Liu, Z.S.; Wang, C.; Ding, Z.M.; He, F.; Wu, Z.B.; et al. Effects of bentonite on the growth process of submerged macrophytes and sediment microenvironment. J. Environ. Manag. 2021, 287, 112308. [Google Scholar] [CrossRef]
  29. Lin, J.S.; Pan, H.Y.; Liu, S.M.; Lai, H.T. Effects of light and microbial activity on the degradation of two fluoroquinolone anti-biotics in pond water and sediment. J. Environ. Sci. Health Part B 2010, 45, 456–465. [Google Scholar] [CrossRef]
  30. Ding, N.; Jin, C.J.; Zhao, N.N.; Zhao, Y.G.; Guo, L.; Gao, M.C.; She, Z.L.; Ji, J.Y. Removal effect of enrofloxacin from mariculture sediments by bioelectrochemical system and analysis of microbial community structure. Environ. Pollut. 2022, 311, 119641. [Google Scholar] [CrossRef]
  31. Chang, J.J.; Ji, B.H.; Li, W.; Wu, J.P. Bellamya aeruginosa (Reeve) regulates bacterial community features in sediment harbouring different submerged macrophytes under different nutrient levels. Aquat. Sci. 2021, 83, 35. [Google Scholar] [CrossRef]
  32. Man, Y.; Wang, J.X.; Tam, N.F.-Y.; Wan, X.; Huang, W.D.; Zheng, Y.; Tang, J.P.; Tao, R.; Yang, Y. Responses of rhizosphere and bulk substrate microbiome to wastewater-borne sulfonamides in constructed wetlands with different plant species. Sci. Total. Environ. 2020, 706, 135955. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, C.; Liu, S.Y.; Zhang, Y.; Liu, B.Y.; He, F.; Xu, D.; Zhou, Q.H.; Wu, Z.B. Bacterial communities and their predicted func-tions explain the sediment nitrogen changes along with submerged macrophyte restoration. Microb. Ecol. 2018, 76, 625–636. [Google Scholar] [CrossRef]
  34. Chao, C.X.; Wang, L.G.; Li, Y.; Yan, Z.W.; Liu, H.M.; Yu, D.; Liu, C.H. Response of sediment and water microbial communities to submerged vegetations restoration in a shallow eutrophic lake. Sci. Total. Environ. 2021, 801, 149701. [Google Scholar] [CrossRef] [PubMed]
  35. Ohore, O.E.; Zhang, S.H.; Guo, S.Z.; Addo, F.G.; Manirakiza, B.; Zhang, W.J. Ciprofloxacin increased abundance of antibiotic resistance genes and shaped microbial community in epiphytic biofilm on Vallisneria spiralis in mesocosmic wetland. Bioresour. Technol. 2021, 323, 124574. [Google Scholar] [CrossRef]
  36. Zhu, H.-Z.; Jiang, M.-Z.; Zhou, N.; Jiang, C.-Y.; Liu, S.-J. Submerged macrophytes recruit unique microbial communities and drive functional zonation in an aquatic system. Appl. Microbiol. Biotechnol. 2021, 105, 7517–7528. [Google Scholar] [CrossRef] [PubMed]
  37. Liu, J.X.; Li, C.; Jing, J.H.; Zhao, P.Y.; Luo, Z.M.; Cao, M.W.; Ma, Z.Z.; Jia, T.; Chai, B.F. Ecological patterns and adaptability of bacterial communities in alkaline copper mine drainage. Water Res. 2018, 133, 99–109. [Google Scholar] [CrossRef]
  38. Solís-González, C.J.; Loza-Tavera, H. Alicycliphilus: Current knowledge and potential for bioremediation of xenobiotics. J. Appl. Microbiol. 2019, 126, 1643–1656. [Google Scholar] [CrossRef] [Green Version]
  39. Wu, H.L.; Wang, X.Z.; He, X.J.; Zhang, S.B.; Liang, R.B.; Shen, J. Effects of root exudates on denitrifier gene abundance, community structure and activity in a micro-polluted constructed wetland. Sci. Total. Environ. 2017, 598, 697–703. [Google Scholar] [CrossRef]
  40. Devarajan, N.; Köhler, T.; Sivalingam, P.; van Delden, C.; Mulaji, C.K.; Mpiana, P.T.; Ibelings, B.W.; Poté, J. Antibiotic resistant Pseudomonas spp. in the aquatic environment: A prevalence study under tropical and temperate climate conditions. Water Res. 2017, 115, 256–265. [Google Scholar] [CrossRef] [Green Version]
Water 15 02493 g001 550
Figure 1. (a) The experimental images. (b) Schematic of the experimental set-up.
Figure 1. (a) The experimental images. (b) Schematic of the experimental set-up.
Water 15 02493 g001
Water 15 02493 g002 550
Figure 2. Growth parameters of the three submerged macrophytes ((A) Fresh weight and RGR of the submerged macrophytes; (B) N and P accumulation of the submereged macrophytes). Significant difference (p < 0.05) between treatments indicated by different letters (A, B, C, a, b) on the bars.
Figure 2. Growth parameters of the three submerged macrophytes ((A) Fresh weight and RGR of the submerged macrophytes; (B) N and P accumulation of the submereged macrophytes). Significant difference (p < 0.05) between treatments indicated by different letters (A, B, C, a, b) on the bars.
Water 15 02493 g002
Water 15 02493 g003 550
Figure 3. Characteristics of overlying water: (a) TOC, (b) TP, (c) TN and (d) NH4+-N concentrations.
Figure 3. Characteristics of overlying water: (a) TOC, (b) TP, (c) TN and (d) NH4+-N concentrations.
Water 15 02493 g003
Water 15 02493 g004 550
Figure 4. Variations of (a) TOC, (b) TN, TP, (c) ENR and (d) CIP concentrations in the sediment.
Figure 4. Variations of (a) TOC, (b) TN, TP, (c) ENR and (d) CIP concentrations in the sediment.
Water 15 02493 g004
Water 15 02493 g005 550
Figure 5. Relative abundance of the main bacterial phyla in sediment samples.
Figure 5. Relative abundance of the main bacterial phyla in sediment samples.
Water 15 02493 g005
Water 15 02493 g006 550
Figure 6. Relative abundance of different genus in sediment samples.
Figure 6. Relative abundance of different genus in sediment samples.
Water 15 02493 g006
Table
Table 1. The richness and diversity indices of microbial communities for sediment samples.
Table 1. The richness and diversity indices of microbial communities for sediment samples.
SampleGood’s Coverage (%)OTUsACEChao1ShannonSimpson
(×10−3)
C. demersum98.4 ± 0.152034 ± 117 b2543.1 ± 164.4 b2528.7 ± 195.0 b5.92 ± 0.1910.5 ± 3.3
V. spiralis98.4 ± 0.072150 ± 70 b,c2638.8 ± 72.9 b,c2598.7 ± 103.7 b,c6.07 ± 0.149.5 ± 4.8
H. verticillata98.6 ± 0.031859 ± 230 a,b2303.5 ± 189.1 a,b2265.5 ± 195.1 a,b5.89 ± 0.329.8 ± 4.2
Control98.6 ± 0.101767 ± 57 a2212.7 ± 98.3 a2205.4± 116.1 a5.83 ± 0.109.8 ± 1.2
Notes: OTUs were defined with a similarity of 97%. Average values and standard deviations (n = 3) are displayed. Significant difference (p < 0.05) between treatments indicated by different letters (a, b, c).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, L.; Liu, L.; Zhang, Y. Effects of Different Submerged Macrophytes on the Water and Sediment in Aquaculture Ponds with Enrofloxacin Residues. Water 2023, 15, 2493. https://doi.org/10.3390/w15132493

AMA Style

Zhang L, Liu L, Zhang Y. Effects of Different Submerged Macrophytes on the Water and Sediment in Aquaculture Ponds with Enrofloxacin Residues. Water. 2023; 15(13):2493. https://doi.org/10.3390/w15132493

Chicago/Turabian Style

Zhang, Lingling, Lizao Liu, and Yuping Zhang. 2023. "Effects of Different Submerged Macrophytes on the Water and Sediment in Aquaculture Ponds with Enrofloxacin Residues" Water 15, no. 13: 2493. https://doi.org/10.3390/w15132493

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop